Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000004
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202302
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200004
Nearest Genes
Gene Nr FlyBase ID Distance
CG2671 FBgn0002121 7649 bp
Sequence Length 995
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCCACCACAGGAGCACGATGTTTTA
Right Primer CGATCGACCAGGACCAACCAGA
Template genomic
Sequence CCCACCACAG GAGCACGATG TTTTAATTGT ATTTCTTTAG CAAGCTGCGC AGAAATTCGG CGGGGCATGT GTGGTGGTGC ATTGCCACTT GCCGACGGGA CGGCAGTTGC CGCGGTCTGC GCTGGTGGCA AATGCAGAAG GAAAACCGAG ACTGTACTGG CATTTGTTGC TGACCACAAA GTTGGCGACG TTATGTTGAC TGAAAATGTA AAAATTATAC AACAAATTAG ATGTACATAT ACAGAACACC AAAAGAATAG ACGCTACAGT CGAGTTACCC ATTACAGAAA TAGTAGGAGG ATAGGTGAAA TTTTAAAAAC AAAATTTGCC ATATAGATCG AAATCGCGAA AACAAAAAGA CTATGATTTA ATTAGTTTAA GAACTGTTTT CCAACTAGTA AATGAAACGA AATCAATATC AATAAAATAT ATTGTCAAAC CAGAGTAAAT GCAAAAGCAC TTTTAACACT TATAGCATAT CGATAGACTA GCAAGGAATA TTGTAATGAC TGAATTTCTT TCTAAGGACG GACATAGTCA AATGTAGTCG GCTGTTTAAA CTGATCATAA ATACATATAC CTTTAAAACT TTGATCAATA TATCCAATGC ATAAAAATTT GTTGCACAAA AATATAATTA AAGCTCTGGG CGTCCCAAAA TGAAAAGCAC TGTATGTTTT TAGCTTTTGG GTTCAATTCT CGCGAGGCCG TGGTTCAGAG ACTATTTCCG TTACCTTTTT TTTTTTTTAT CGTTACATCA AAACTAATAA CAGTACAAAA TGTTGATTAC CATTAGTAAC ATAAGTTTTG GCAAATAGTA AACATCGCAC CATGGATCCT AGCCCGTCAT CTGCACAACG AGCCTCTATT TGCCTCTCGA CGGGTCTTGC TTCCAGCTGT AGGATTGTGA ATTTAATATA AAAGACTAGT TGAGTATATA TTATCTTACT AACCGTTGTT GGTACTTGAT TGCTCTGGTT GGTCCTGGTC GATCG