Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000003
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202301
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200003
Nearest Genes
Gene Nr FlyBase ID Distance
CG2671 FBgn0002121 9523 bp
Sequence Length 606
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGGCGTTCCTATTTTGTTGTCTCCGT
Right Primer TTGACTCGGTGCGCGACCATTT
Template genomic
Sequence TGGCGTTCCT ATTTTGTTGT CTCCGTTCGT TTTTTCATGA GAAATGTTTG TAATTATAGA TTTAATTACA ACAGAACTAG TACTCGTTTC CGTCGTATTT CTGTTAGGTA AAAAAAAAAA ATTAGTAGGT TAAAGCTTAT GTCAATGTTT CTTGTAGAAG CACACCTTTT CGATTCCAAG TCCTCTAAAT TAGAAATATT AATATTTGGA ATTTCACTCA TGTTTACGGT AGTACTGGCT TTGTTGGTTT GCGTGCTAAG TACAGATAGG CGACCTACAT TTTCATAGAG ATGACAGAAA AAAAAAGTTA TGTACAGATA TAATGTGGGC CCGTGCTTTT AAAATAAGAT AAAAGTATAT ATTTAAAGTT GTTTGGTGCG TATACTTAAA ATCAAGTTTT TAAAAAGTAA ATTTTTATAA GAATTATGTT GCCGAAAGTA ACTAATGTCG AAACGAAAAC ATTTAAATGT AGATACGTAC AAAACAGCAA ATTAAAATAG GTGGAATAAT GTTAGTAAAT AAATGATTAC TCACCAATGG TTTCCTCTGT ATTAATAGAA CACAAAGTGG TGGTCGTCAT ATTTAAATGG TCGCGCACCG AGTCAA