Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000002
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202300
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200002
Nearest Genes
Gene Nr FlyBase ID Distance
CG11023 FBgn0031208 1882 bp
CG2671 FBgn0002121 11321 bp
Sequence Length 643
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer TGTGCTGGTGCAATAACTTGTTCTCAT
Right Primer TCCTGACGATTTGTAGTAATTGTTTTGTTCT
Template genomic
Sequence TGTGCTGGTG CAATAACTTG TTCTCATATC TGATTGTAAC AGAGAATCTA GTTTTTCAAT AAAATTTCCC CAAGTAAAAA CAATGCGAAT AGGGACGTAT TAATTGCCGA ATCTCTTCGA GTTAATAATT AATTTTTACA ATACAGCAAG CTGAGAATAT GCAATTGTAA TGTCCAATTC AATATTTGTA ATTTACTATT TTAAGCCTAA CTCTTATCTA GGGATTACTC GATTCCAACT ATATTAGAGT AGAAGAAAAC AATTTATTGT AACGAAGTAC AAAGATCATT CTAGAAAATC ACTCATACAA ACCTCTAAGG CTCAAAACCG AGGTATGATC TTTAAATAAG TCAAAATTAG GAGTTTTCAG TTTGAGACCT ACAACTAAAT AGATCGGTGT TCTTCCACAA AATATTGTAA AGCCAGTTTG TTAAATAAAA TACATGTTTT ATTAATAATC CTAAGCTAAA TACTCAATTA TATACTTTAT ATGGTCGGAA AAGCTTCCTT CTGCCTGTAA CATACTTCTC AACGAATCTA CAATACTATT GTATATACTA TACCTTTTAC TATACGAGTA ACGGAGTAAC GGAGGAGAAT GCAAAAAAGC TAAGAACAAA ACAATTACTA CAAATCGTCA GGA