Vienna Tile Information
VT ID VT033006
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202281
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 233006
Nearest Genes
Gene Nr FlyBase ID Distance
CG3979 FBgn0036816 9148 bp
Sequence Length 2156
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGGAGCCTGTTTTTAATTACAGCCCAGTT
Right Primer CGGAGGGGATGGCGGCTTTT
Template genomic
Sequence TGGAGCCTGT TTTTAATTAC AGCCCAGTTT CATAGTGCTA ACTTCTATAG TTTGATTTAA ACCATTTTTG TAGTGGGTTT AAACGTAGTT GTCAATCAAA AGTAAATAGA CTTTTGAGCC CATAAAACAT AAAACGGAAC TTTGGAGGTT CCTAACTCCA AGCGTAGAAA TCATATTCCA TTGTCATATT CATAGTCAAG CACCATAAAA TTTCTAAATT GAGAGTAATC AAAAATATGT ATATATTCGA ATGGATAACA AATGCGTAAC ATAATAAAAC AAATAGATGA CAGAACTATG ATTGAAAAAA GAGAACTTTT ACTAAAAGCT CAGGATAACA AATTCCTGTA AAAATTTCGC AATACAAAAA CATAGTCCAA TGACCGAAAA AAACGTAAAA ATCAATCAAA ACTAAACAAA AAAAAATCAT AATTAAAAAA TTAAGAAAGA ATATAATATT AAATATATAA AAAATAAAAA ATATAAACAG GAAGTAAGAT AATTTGGCAT GCCGAAGCTT TCATACGTAC CCTTGCAGTT ATTTATACAT TAAATTCCAA TATTAACGAA TATTACATAA TGTCAAAAAA ATTAATTAAA TAGTACATCT ATTACAGTTC ATTTAGTAGT TAGGTGATAT AGTCGTACAA TTTGATGAAT TAAAAACCGA AATGACATAT TGTTGAAAAC CTGGTGTATA CCGAAATAGA ACGCTTTATG GTCAAAAACA AAGAACCAAT GATTTATTTC CCATTAATTA GATAGTATTT TCCTGGATGG TTATATGGCA GATATATGAT ACAGTTGTCC GATCCTTATT ATTGTACATT TTCAAATTAA AATTATATAT TGTCGAAAAA CAGGTGTATA CCGAATTTTA ACCTTTTTAT GATCAAAACA AAAAACAAAG AAATTTTATT TGTATTTCCG ATTATTCCTT TATCATAGTA GGAGTAGGAA GGACTCGGAT GTTGATAGCG ATCAGAAATG TTTAAATTTA TAAGGACGCA AGTGTCTCCT TTACTGAGTT GCACGGTTCT CAATAAAATC AATATACCAT CTGCAAGGGT ATAACAACAA ACATTGTTGT CATTTTGAAC TTTAATCTTG ATATCGAAAA CCCATAGTAC ATTATAAAAA TGCTTGGCCA AAAACTGAAC TTAACCTGGT TCAAAAGGAC TGCCAAACTT TTTTAAAACA CAAATTGTTT CATAACTTTT TCCAAATTTC TTAGAGCCAT AACTTCACAT GGTAACAATT TAACATATTA ATACGAGTAG CTTTCTAATG ACAATATTAT AAACCCAATG GAGTTTTTTT TGCATGTCTG TACATTAGCA GAATAAAATA GTTTCTTTTC TTTCCTCTCT ATTGGATAAG TGAAAAAATA TTCAATATTA AGTCACAATC ATATGACCAG AAATAATTTA TCTTCAACCT TCAAAAATAA TCTGATATTT AATTTCAAAA TAACATCTGT TAGTCCGACA AAGAATTGCA AAATGGCTTC ACACATAAAC AACAGCAGAT ATAAAAATTA AGACTCGCTG AACGAAAATA CACAAGAATA TTCGAATTTC CTTCCATATT GCATTTCAAA CTTTTGCAAA AAATAATTCG CTTCAAATGA ATTGCCGAAT GACATGCCCA GAAATAACAT TTCGCACAAA ACATGCTCCG AACTGTTTAA ATTATGCACA AATTAAAGCA ATTCCCCCGC TGATTCGGAC AATTCCTCTG ACATTGTATC AATCTATAAA TGGAGGGAAT ATTTTCCGAC ATTTTCCGGC AATTAGCAGC TAAAGCCTGA ACTTAATACA CGTGCGTACA CCTGAACTCT TGACACGAAG TGCTGTCCCC GCATTTCCAC AACTCTTGCT TGCTCTCGCC ACTGCCAGCG ATCAAATGAA AAGCCGGAAA ATGCACTTTC CATGTTAGCT GCTAGTCAAA CTGCTTAATT GCGCATTAAA TATGCAGAAA AGTAGGCAAA ACGAGCGGAA AATATGCGCA AGGGTAAGGG ATCGGCATCG GAAACTGGGA AGTCCTGCGC TGACCAAATT GCTGTGGCAA GTGTGGAAAT ATATCGTATC AACAGACATT ATTGCGCTTG ACAGTTTTTA CTGTCAAGCC CCCCGGAAAA GCCGCCATCC CCTCCG