Vienna Tile Information
VT ID VT025803
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202269
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 225803
Nearest Genes
Gene Nr FlyBase ID Distance
CG7503 FBgn0005775 14 bp
Sequence Length 2102
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer TGCGGTCGAAATAATAGTGCTTGCG
Right Primer AGGCGGTCTTTGTGTCAACAACGTG
Template genomic
Sequence TGCGGTCGAA ATAATAGTGC TTGCGAAAAA ATAGGACTAC ACAACAAGAC AATATTAACA ATTAAATACA TAATTAATCT ACAAATAATA CTTATTAACA CACACTACAA GCACTTTTTG CTTGTAGTAA GTTGACAGCC ATTGATGATA CGAATCGAGC TAGTTAATAA TGGAACTAGC AAACGTTTGA TATCAACAAT TACTCTCTCA TATTAGTAAA TAACACACAA TTAGTAGATA TGAAATACAA AGTAGGCGAA TCCTAAAACT GACTAAGTAC TTTCCAGAGT TCATAATATT GAAACTGAGA CTAAGATTTT ATAAAAATAT TTAAAGCAGC TCTATTAGTT TGCCCTCTTC TGTAAGCCTT TCACTGCATA TGTGTCCGTA TTTCGGGTTG TGAATCTCCG ACCACAGTTG ACAGTGATTT AGTTTTTGGC TGCGAGTCCA TTACACGAGG TTTTGTGGGC CCAAAGAGTT GGAACGGACT ACAAGCAGCC CAAGGTTAAT GTTAAATCTA GCAACTTTTA GTTCCCGCCA TTTATCAGTG GAAACGGAGT GGGCAGAAGT GGCCGATGGG GAGTTCCGCA TACTTAAATT GCATTTAAAA ATCCCGACTT GGAGACACTT TTTCGGGTAT CTATTTACGT TTGCGATTTG TCAAATGGAA TTTCGTTCGT TTTGCGTTTT TCTTAGCTTT TCGCAAAGTT AATTTGCCGA CATTTAGCCG AGAATAGGAA AAAATGAAGA ACAACTTTGA AAGCAAGAGT GGAAAAGGAC ACCCTGGGTG CCCGAGAGCT GGAATTCATT TTATTGAATT AAATTCTGAG AAATGTCCCT GGGATTTGTT TGCCTTTGTT TGCTGCCGCC GCTGCTGCTG GCGGAGCTGC CATTTGTTTG TTCGTTTGTT TGTTTGTTTG TCTGGCAAAA GTTTTCCAAC TGCGAGGAAT TCGCTGACTT TGTTTAGCCC ACTTAGCAGG GCAATATGTA TAAATAAATA CGCATAAGTA TACATCATAG AAACATGATT TCTTTCGTTT TTATTGTGTG TTTGCCTTCC CTGGCAGCTT CTTTCCACCG TCCTCAGGGT GTTTGAGCGT CCATTGACCC ACAAAAAAGT ACTTCGAAAG TCGGCACAGA AGCCTAGAAA AATGTCAAGT GGCTTGATCT AAAAACCTGC CATTACGAAC TGCGGGGCCT TTAAGTTTTG AAGCGCCAAA AATTCTAGAA CGCCTCTTAA ATGATACTTT TTGGCACAAT GCTTAAAGAA TTAGCTTTGT TAGCTTCAAA TCGAAAAAAA AGAAATAATT ATATTTTGAC TCCTAAATAA ATTCATCTTT ATTTGAAGTA CTTTATGTGT TGTAAATGCT TTCTTTGGGT TTAAGCATTA AAAAAAAAGG TAAATCTTTC CCATTTTGTT TAACATTGCT TGTCACTTTG GTAGATCTAA GTTGCGGTTG ATTTATATGG TACTGAGCAA TAAATCAATT TTTTGTACAC ATCTTGTAAA TCTCTTTTTT ATTAATGCAT TTCCTTCGCA TATATTTTGC GTTCCTTATT TTTTGGGCAT TTTTTATTGT TTGACTATTT TCCTAATAAC TTATAAAAAA GACTGACTCT AACGAGATTT GAATATGCCA TTTGATTTCA CTGTAAGTCG CCAAAAAGTA TGCTGCACAA ATACGAATAT TTCCTTAGTT TCGGTTTTGT ATTCCCTCTT TTCCTTTTTA TTTTACTTGC ACCAAAAAAA CGGAACTTAC TTGACTGTTT TTCTTTTTTC TTGTTTCTTT GGGAGATGAA TGCTCCACTT TGCACGAACA CTGCGACACT GATATATCTT CCTGGCCGAT ACGATCGAGT CGTGTTTTGC ACTTGTTCAA ATTCGGGAAA TGTGGAAAGC GGCGAAATTG TTGCAATTAA ATTACGCTTA AGACTTGTTG CACTTTGGCA CGCACACTTG CTTATGGGGC CGAGAAAAAC ACACAAGCAC TTTGGTCGTT AGTCCTGGTG AAAAACGCGA GCGGAAAATC GCGAGGGGCG ATTGCTGGTT TTTCGATTTT TCACGGGGAG CGAGCAACAC GTTGTTGACA CAAAGACCGC CT