Vienna Tile Information
VT ID VT025784
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202267
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 225784
Nearest Genes
Gene Nr FlyBase ID Distance
CG7503 FBgn0005775 32501 bp
Sequence Length 2160
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TATGCACAGCCGGAGGAGCAGACTA
Right Primer GCGTGGAGAAAGGCGAAGGACAAC
Template genomic
Sequence TATGCACAGC CGGAGGAGCA GACTATGTAT ACTTGGAAGC CGGTCCGGAA AAATGTTGGA AAAATGGCCA ACGACTTGGC AACATTTAGC AAGCAAATTA CAACAAAATT AACATGATAA TGAAGTGACC CAGCTGGGTG GTGTGGAAAA AGCTGGAAGG TGGATGAGGA TGAGAATGTG GCCATGGGTG GGTGGACGTT GCAGTTGGCA GCTGTTCGCA GCTGACCAAA TGACAATGAC TTGCCCCCAG ACAACGTTCC ATAAAAGTGC TTAAAAAAAT AAAAATTACA AAAAATATGT GTATAGAAAA TGAGCGGGGT GGAGAAAATG GATCCGAGGA CACTAGACTG TGGCACTTTG TGTGGCATAA AATACTTTTA TATTTTTAAT GATACTTGGC CAAAGCGGTA GGAAGTGTTT TGGTCTGCTG CACACACTCC GGTACACACA CACACACACG CGCCCCGCTC ACCACTCTGT TGGCATGCAA TGAACTCCCT CAACCCATGA CAACCACGCC CCCTTATTGC CATATATGTA CATGTGTATG TGTGGCTAGA GAACTGCGGC TGTTAGTCAA CTAGATGACT TTCAACTTTA ACAGCTCCTG CTCCTCTTAC TCAACCCCTC TGCTTAACAC TGTCAAAAAA TATTAACACC CCCTAATAAA TAAGAGTTTG ATGAATATAT TTCTTTGAAT ATCCTTTTCT ATATCCATTT TATCTCAGAA GAAATCTTGA TATGTAACCA CTGTTCAATG AAATATGTAT TAGAGCTCTC AAGCCTCCAA AGTATGATCC TATCTAGCAA TTTCAAGTCG ACCAAAGTTC GTCTCAGTGT ATGATGACGC AGTAGCTTTT CTTTCATTTT GGGTTAAAAT TTGGCGAGGG GACAGAGAAC TGTCGGAAAC GTTTTTACGG TTAGCAAAGG ACATTTACAT ACACACTGAC ACAGTGGGAG GACCTGCTCC ACATGCATGC ATGCGTCTGT GTGTACATTA AATTTTATTA TTGTCATTTT CATGGCGTTG TCGGACGGAT TCGGACCCCT TTTCCCCTTC CCCTTTCCTA TTCCCTTACC CTTTTCCCAT TTCCCTTTTC CCGCCCATAA CTTTTCGGTC AGCTCTATTT GCATAAGTTC AGTTTTGTGT GCGCGTGTGA GTGCGGTGCA GCCAAATTAG ACTCAACTGG AACTTTGTTT GGTCAGTTTT AATGCCGATG TGTCTGTGAG GCATTTCATG TGTTGAAACA TATTCATAAT TAGTTGTCAG TGCGGGAAGG AACGGGGACA TTGAGGGCCG GAATGTGGAC TCCTTTGATT GGCTTTGTTT GCACAAGATG TTTGCCCTTT ATCGAGGGTA TATGTATAAG TTTTCCCTGG TATTATTTTA CAGTGGCTGA AATGGCAGCA ATCCTTCATC ATGAGTCCTG GCAGCGGCCT CTGCGGCCTT TTTTCTTCTG CACACCCTCT AAATGGCGTT TCATTAACAT TTATTTTAAA TTTATTATAC TAAAACTGTA GCTTGCCGAC CAAAGCAGGA AAAAGTTTCA AAAGGAAAAG GCAAAAATTC GCTTTAATTG GCTGGTTTTA GGTGCTGCCT GCCACATTAA CCCATGCTGG CCCCTCTCGG CACCTACTTC CGTACATATA TTGAAAAGCG CAAAGAAATC GCTGGGTTTT TCGCCTTTTT GCGTTATTTT TTTTTTTTTT TGGTTGGTTG AGGGGTGGAA ATATCAACAC AAACGGCCAA AGTTTCTGCA CGCCCCCAAA TCAGCACAGC TGCTGGCCTA GTTTTAAGGC CTTTGTTTCA CCCTGGACTA CGGTTTTTTT TTTTTTTGTA CTCCGGACTC TTTTCAATCC CGACCGCGTC GGGGTCACCA GGAATCCATG AATGGCGCGC AGCTTTGTTT GAAATCAGCT CATTTTTGGC GGGCTCGCCA ACTGGCCAAC GCCGGGCTTC AGGCTTTTGG CCAACTGGGA AAACTGCTAG CTGGTAGCTG GTAACTGGTA ACTGGTAGTA ACTGGGAACT GGGTTCGTTT GCGGTGGTCC GCCTTTGGCC GCCACTAGGG GACAGCACGC ACAGTTGCCA GTTACCCTGC TGGGGGGTGA ACTGGGGTCA AAGGGGGCGT GGCAGCGTTG TCCTTCGCCT TTCTCCACGC