Vienna Tile Information
VT ID VT014718
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202260
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 214718
Nearest Genes
Gene Nr FlyBase ID Distance
CG11895 FBgn0024836 16042 bp
CG12934 FBgn0033541 38875 bp
Sequence Length 2080
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer CGTTTTCGACTCATAAAGCAATTTAATGGTAA
Right Primer GCTTTGGTTTATGGGCGGTAGAGAA
Template genomic
Sequence CGTTTTCGAC TCATAAAGCA ATTTAATGGT AAAATATAAA ATTGTTTCAA ATTTACATGT CTTGCTTTTT CGCCCTGCTC GATTCATGGC ATATGCATAA TAATAACTTC ATATTTAGTT AGTTTTTTCA TCCAAAATTT TAGTTTGCTG TACTTCACCC AACAAATTCA AAGCTGACGT ATTCTGAAAA TCGACGGGCT CTAGACTCTA GTCAAGTGTG CCATAGCCAA TGAGCTCGTG ACATGAGCAA GCGATTAAGG GATATAAGTA AAAGCATCTG ACATTTGCTA GCTGAACTGC ATGGCACTCA GACTCGCCCC AGTTTTTACC AACGGACCCG AAACTAATTG TTTGCTTTGG GCCAGAAGGC CGGGCAAACT TTTTCGATTA CAAAATTGTT TCGGTGCGGA ATGGCCGGCA AGGCGATACA ATTTTTAGAA ATTTCCATTA TCCTTTCGGC ATCACGTCGG CGTATGCAAA CATTTGCCAT TTGCCAACTT TGGCTAGCCA GTGGGATAAA ATGGGGCGCG ATGCTGGCGC AAACTATTCA ACAGTCGGTC AGCGTTTTTA GTTTCATTTG CAGCAGCGGC TAAAGCAAAG CGAAAGCAAT TTACACGCAT TTCGGCGCAA AACGAAACGT GCCCCGCCAC TAAAATGTTT ATGAGCGCGG ACTACGAAAT GTGAAATGTG AGCTGGTGTG GTGGAGCAAA GGATTCCGGA TTTGGGGGTC AGCAAATGGA AGCCGGAGCT CTAAGCCCGA GCTGATGAAA TAGAACAAAG CCATAAACCC GAGAAGTGAA AGCGGGAGGT CGAGGGCGAA GGCGAGGGCT TTCCCTTTTT CTTTTTTTGT TTCTGGTCAG CACAAGTCGG TCAAGAGAAG TCGGAGTCGC GGGGTAGGAA CCCCTAACAT TCTTTACGCC CCAGGGATCT GAATGGGTTG TCCGTTTGGA GAGTGTTGCA ATTGTTTTGC TGCTGCAGCA CTTAGCCTTT ACGATCCCTT TAGAACTGTT CATCTCACTC GAGGAGAAGT TGCCTACTTA ACATGGCCAC TTTCGGCCCT CTTTTGCAGA TTGCCAAAGC AATTTGAATT AGGTTTGTGA TTCCCTGTCG AACGATTTGC CCTGGCAACG ATTCTCCGGC AGCTTAGTGA AAAATGCATG CTGAAATCAA TGAAGCAAAA AGCCCGAAAT ATTCATGGAG CACGAATTCC GACTGCATTC GCTCAAATGC AAAAGTGGGG CTTAGGGGTG CGATTAAATG GGCAAACAAT ATTTCTGCCC CGGACAATTG AACATCTGAA ATTGTTGCAT ATTTTCCAGC ACATTCCGAC GAATTTGCAT CCGGCTTAAA TCGATATAGC TCAGTCTTAG CTTTGTGAAA TTACCAAACT TCAGCTGCAG TCTGCCGTTC AATAGAGTCG ACAACAATCG CCAATTCAAG TTGGCTCAAC TCAACTTTCG ATGCAACTTC TCCCTCGCCC ATTGTAAATT GAAATACTTT ACCCGGCTAA AAGTTGCAAG TTTACAAGTT TCTGTTCAGT TTCACTTGGT ATCTGCTCAT AATATTTTCC ATTAATGGCG GAAAACTTAA TTTATGTCAC GTCCCAGACA TCGTGAAAAA TGCGCGTTTT ATTTTCTTGT ATTTTGTTTT ATTTTACGGC ACCAGGCGAC CTAGTAAAAA TATTTTGAAA AGCATTTGGC TGGCTACGTG ATGTTCGTCT TAAACTGCAG GATCAACTGG CAGTCACGTG GGCGTCGTTT AAATGGGTTC CAGAGCTCCG AATAGGAATC GCCAGTGGTA GGAGTAATGG TGCAGGGTTA AGGGTCGAGC TATGGTGGGT TAATCAAAGC TGTCTATGCT TTATGTCTTT CCTTACAAAA TTTCTATTTA ATTAATCTAT GCAGGGCAGG AGTTGGTGAA CCTTTTAAAG GAAGCTAGTT TAATTGAATT TTATTAAAAA AAAAATAAAT TCACTTACAA TTTGGTAGTA AAAATATGTA ACATATTTCT CATCATGTAT CAAGTCTTAA AAAAATATTT AGCTATTTCT CTTATTTCTC TACCGCCCAT AAACCAAAGC