Vienna Tile Information
VT ID VT003229
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202190
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 203229
Nearest Genes
Gene Nr FlyBase ID Distance
CG42369 FBgn0259715 0 bp
CG42368 FBgn0259714 12161 bp
Sequence Length 2100
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer ATGAGCGGCAAGAGGCACACCC
Right Primer TGTATGTGCGATGCTCTATATTGGCCC
Template genomic
Sequence ATGAGCGGCA AGAGGCACAC CCATGGCAGC CACCACTCGA TCATCATCTT AGAGGGAGCT GGCTCCAACT GATTTTGATT GCAGAAACTG CGTTGTTGTC GCCGCCAGTT GGCTGATTAG ACGAAGGGGC TTAGATTGGG GTCAGTAGTC AAGTCGGTGA TGCGGTTAGT TCGTCTGATA TGCCAAGCCG ACCACTGACG ATTAACCAGT GCGAAAGCGA ACTGCGCTCA GTTCGACAGC CTTATCGCTA CGGAGCTGGC ACTGAGAGAA ATAATGGGTA ATCCAATTCG TGCAAATTAT ATTATATTTT ATTTTCTGCT AATAATCGAA CGCAAATTAA GGACAGCGAA AATAAGAAAG GAAAGAGTTC AGCGCTGATT ACAATTCCTC TGTCAGAAAC CAGCACAATT TAATACATAA CTTTTTATTT GAAGGTAATG CATTTTTATC CTTTCCCCAT TTCGACAACT ATTGTTCGTC GAAAGGGCAT TAGTGGCAAC AACTGACTGG TGAATCGGGA TAGGATTGAA TGAGGGAATC GATTCGCTGT AACCTGGTGC CCGTGCAACT GCAAATGGCC AGGACATTGG TCCCTACAAT GTATCAAATA GTCAGCGCTC CTTCCCAATT TGTCTGTGCG GGCAATTGTT GACCGAACTC AAACTGAGCG CGTGTGCGGG ATACCTATCA CAAGTTAGCT TAAAGTTGCA GACTGCAGAC TGCTGCCATT TGACGACAGA ACTTCAGCGG AATCCCAAAT GGGATGTGGC ATGAATCCAC ATGGATTCCA AATCAGCGAT GCTCGTCGTT CTTCATTCTA TGGCGCAGCT TGATTGAAGT TCGTCAAATT GATTGAACTC ATGCCACTTC CCCTTTGCCA ACTTTTAGCG AAAACACTTG ATTTCGATTT CGTTCGAACA TTTCTGTGCA TTAGCCTTTA ATATTCGATC AAAGGGTATC TGCAACCGCA TAATGGCCAA CACCTTTTAA GACGAAACCC AAAACGCAAA AAAAAACTAT GGAAACGGTT TGGCAAAGAG CGTAAAAATG GGGAAAAATG GTTAAGAAAA AATGAAAGGC ACACCGATAA AGTTTTTAGG AAAAAAAAAA ATGTAAGAAA AAATAAAAGA TACCAAAAAC CTGAAGAAGA AATTTTCCAA CAATTGCACA ATTGGCATGG GCTACGCATT CGCTTCAATG GCGAACGACC AAGACACTTT GATTCAAACT GTGGCCAAGG ACAAAGGATT TCTGGAGGAC GAAAGCCAAG GAGTCATGGC TGGAGGAACG GCTGCCCTCC ACATTGCTGG CACTTAAGTG ACAAAATCTA TTCGCAAGAA AGTCATCTGG TTAGGGTATC TACTAGCCCA TAGAGCTTTG CTCCGGTCAC TCATGGTCGG TCATTTTATT CTTATACTTC GCCAGTGATG CCTTTGAGAA AAACTTTGCC ACTTTTTCCA TCATCGCCGA CAGTTTTCCT TTTTTTTTTT TTTGTCTTTC TGTTTTTTCG GTAACAAAGC CGAAACTAAA CTTTCCAGCG CTTTGCCAGA CGGGTGGAAA TTCTCGCTGG CCAGGGGCGT GAAAAGCGCT AAAAGCGTTT TAATGATTTT AAAGGAGTTA AACTTTTGTT TTTTTCAAAA CACTTCTTAT GCGCTTTCTT CATTGTCCGA AAAAATTGCT CTTCTTTTTG AACAATTGTT TTGGTTATAC TGTGCTTTGA TTTTATCGCT CATCCCGCGC GTTGACCGAG CATCATTCTA AGTTACATTC TAAGTTGTGC TCTTTTATAT GAATAAATAC CCTGTACTCC TAGAGGCATT GGGTATGCAC ACATCTATAT CCAATAAAGA TGTTGGACAG TCATCTGTAT AAGAGAATTT TAAGTTCTTT CAGCTACATT ACTTGGGATC AGAATTCCCA AAGTAAATAC AAATGCGAAA AGTACTTAAT GCAAGATTTC ATGATTTCCA TTTAAATCGA AGATATTGTC ATAAAATTAT CTCAGTGTAT TTATCTGTCC TTCTATTTTG CTTCATTGTT TACTCAACTT GACAGATTAA GTAAATGCTT GAGGGGCCAA TATAGAGCAT CGCACATACA