Vienna Tile Information
VT ID VT008279
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202173
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 208279
Nearest Genes
Gene Nr FlyBase ID Distance
CG31819 FBgn0028893 14001 bp
CG4894 FBgn0001991 24623 bp
Sequence Length 2181
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer TGGGTCTTCCAACTTCTTTCATTCGCT
Right Primer AACGGGGTGTGGGAATCGTTATTT
Template genomic
Sequence TGGGTCTTCC AACTTCTTTC ATTCGCTTGC AAATTCATTT TTCGTCGGCA CGTGAGTTGA TTTAAAAGCT GCAAGGAAAG AGATTTTTGG CAGTCAACTT AAATTTATTT GACTGCTTGA TTCATACGAA ATCAAAGGTA AAGGTAAATT CAATTTTTTC CGAGCTGAAT TTTTGATAGC CAAGTGATGT AATTTCTCTG ACTGAAGGTA ATAAAGTTGA AGCAACATTC TGTTCGGCGT GGAATTCAAA AATTATTCTT CACCAGATCA GGGTGTATAT GATATTTCGA TATTTTATGA AATGATTTAA TACATTTTGA ATTATTAAGG ACATTTGCCA CATTATCTCT CTCTTTAATT CACTTAACTT AAAACCGGTT TTGGGTCATT CCATCTATCA TTCACAGAAG CCAAAATGTA ACTTTTCCAA CCAGCTTCAA TAATGTAGCC ATACTCTCTG ATTTAAATTC GTGCGATTCT AATTGGTGTA AAGCAATTTT ATGGCTGTTG ACCGGAATGT GCGAAATTTT CAACTAATTT TGATGTTTTG CCACACAAAC TGCAGTAAGG CAACCCACAT ATTTCGCCTC CCAGCAGTGA AAGACGTGTG GAGTCGAACT CTCTTCAAAT TTGTGATGTC CAAAGGACAT AGGACATTCC ATCAGAGTGC CAATGGCGAA GTACTAATTA CAAACATGTC GCCGGTTCAT TCAGTTCGGA TTTGGGTTTT GGCCACCATC CTAGTTGTCC ATTTCCATGC TCGGGCCATC ATCATCTCAT TTTCCCCGAA ACTAAATTTG TATGTTGGGG TTTTTGGGCA CTTTGATTTG TGATTTGATT TGCACTCAAC CAGCCGAGAG TTCTATGACT GCAGTAGCAT TCGGGTAATT ATGATGTACG GCTGCAGAGA ACATGTAAAG TTCGACCAAC TTCGCCTGAT GGCCATTGAC CCGGCTTTAT CTAAGCACTC AGACACAAAC AATGATAATG GCTGCCCTTT GTTCGCATTC GACCAAGACG CCAACAATTG TTTGGAATTT ATGAAGAGCT TCCTGAGTCC GGAATACTGA CCTGACAGAT GTTCAAGTAA GTACAATTGT TGCCACTTAG GATGCACTTA CAACTGTTTT AACTTGAAGT CTCACATATC ATAAAATTTG GGTTCAAAGT TCATCCACTT CCTGGATGAA AAAGCACTTA ATGCAAATGC CAGTTCAAAT GCTAAAATTA TGAAGCTAGC TCTAATTTCG TCACGATTCA AGATAACGTT GATTTTTACC TACTTGGCAT AATCATGACA ACTTGATTTT AGTTTCATTT GGGATTAAGC ATAAAATGCT AGATTATAGT AAATTAGTAA TGACTTCCAA GACAACACAC AGCACTTATT GCCCAATTCC TTTTGTCGTT GCCTAATTAT TTATAAATAT TTATTTAGTG TGCAAATTAC CAGACTGTAC TGGCAATATT GTCGTCAATT AAGTCAGGTA CCAAAGCATA AATATTTACT CAATGCGAAG GCAATGATAA TATGCTCAAT TTGAGATGTA TCCCTTGCAT TTTGGCAATA TTTGTGGGGC AATGAAAAGC ACGCACACTT ACATGAGCTA CCCAAACTTT CCTTTGGGCC TGAGTTTCCT AATTATTTGC CATTTTGGCT ACACGCTCTT GGGTTTATTG ATCATACTCG GTCAGATTTT GGTATGACTA GGAATTGAGA AAATGCCTGT TTGAACATTT TACTCATTTA TGGTCACAAC AATATGATGA CAAAAGTTTC TGGGCCTGGG TTTATGATTC CGTTTGGTTA GTTTGCAGTT CTGTTTTGTT TTCCTTCCAT TTTGCATATA TTTTATGATG CAAGTACGTT GGGCAGAGAG GGGAGTGCAA GTTTTGGGCA GGCCATATTA AATTAGTTTA GAAATTGTTG CCCTATAAAC AAGTAGATTT GCATATCTCT TCCGCTTTTC TCTGGCCATA CATATGTCTG GAGTATAGAG AATACAAACA ATATGTTTTC ACTCAGTGGC GTTCACTTAT TAAGATATAT ACATTGTATT TTTATTTTAT TCAAGTACAG TTGTCTTAAT TTAAGTGAAC ATATAATTGT ATTTGATGGG AGAAATAATT ATCATTTAGT TATGCAGACG TTGAGTTAAA TAACGATTCC CACACCCCGT T