Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000106
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202092
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200106
Nearest Genes
Gene Nr FlyBase ID Distance
CG13693 FBgn0031235 0 bp
CG3696 FBgn0086902 18185 bp
Sequence Length 2114
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGCCAAGTGTTTAGCAGATGACTCCG
Right Primer GCGTGTCGGTTTTAAGGCTGTGTCC
Template genomic
Sequence TGCCAAGTGT TTAGCAGATG ACTCCGAGTG CCACGCCTAC CTGATAGGCG TGTTGTCCTT TATCTGCTGA ACAAAGTCGC CAATAACCTC ATGTTGAATA TAATAGAGCA TCCTCACGCG CAGCAAAACC CTGTAAATGT TTACATTAAA TAAACAAAAT GTATGAAAAT AAAGGGAAAA GAGAGCGAAA AAAATTGTTA GCAACAGTCC ATCTCAAATT TGGAAATATC TTATAACGAG TTCGATTCCA CACGACTCAC TTATTGGCGT GTCTGCCTAA ATGCTTCTTG TAGGCGCCTT CCAAGTACGC ATCAGCGTCG TACTTCTCCT TCTTGCTCCA GTGATTTGGA TCGTGAATGC TTGTGACCGC CGCGGCTACT GCGCTGGCAT TTATGCCGCC GCTGTCCTTA TCGGACCCAT CCAGCGCACT AGATTTGTGA GCCGGAGTCG TGTTTCCACT ATTGCTTCCG GATGCAGAGC CCGGAGCAGG AGTAGACACT CCTGTGGATT CTTTGTTTGA CTTTCCACCG TTGCGACCTG TAAAGCAAAA GTAGTGTTTA CACAAACATT AGTATATTCA TATTTCTCTA GCTGCCTTCA GACTGATATA TACACTAATC TGAAGGACAA CAAAGCTCTA GGTATCAAAA TGTAAAATCA AAATGAATTT ACAGCACCAC CGGATCTCTG ATCGTTTTCG TTTAAAAGAG GTGTTTTTGA AGGGTACTTA ATATAATTGG CTATAATTTA AAATATTGCC TATACATGAA AATGATACAC AAGGGATATA TGATTTTAAA AATTAAATAC ATATTAAAAA TTAAATAGTT TAAAATTTCG AGATATTATG TATCTTTCCT ACAATGTTAC CTTTTAAGCT AGCACATTGT TCGACTCAAC AACAGCAAAT AAAAAATAAA TTAGTAGTAA ATTAGAAAAT GGTTTAGGCT ACTCTATATA AAGAGTTAAT ATGAATTTTA AAGGGTATGT AAGTAAAATG TTATTTATTA TGTACATAAA AGTAACAGAT TTGATATAGT AAAAGGCATA CATTTGCATG GCAACAAAAC ATACACACAC TTCTTTTCGT CGCGTCGCGT ATATGAGTCA ATAATTTATG TCTCTGTTCT GGTTCAGTCT TTATTGGGTG ATTCGATTTA ATATTGAAGG AAGTTTTTAC GGAGGAGAGG CCATTAGACA CACAAATTAA ATTATATTCT TGCTTTAAGT ATCTGACATT TACGGATACA AATAAGTAGA AGAACGCAAT TAAAATGATG TAGAAAGTCC AGAGCCCAGT ACAGATAGCA TAAAGAAATT TTTTTACAAA ACGTGTTTGC TATTTTTTTC TGGTAGACCG TTTCGTTTAT ATTACTTTTG TATTGGTTTT TTAAAACTCT CTACGTCCGT GCAGCAGTTG GAGTGTGCGT AAATGTATCT TTTACCATAC CTTTGGCATT CCTACCTCGT GGCACCAAGT TGTGTAGGCC ACTATGATCC CTGCTAATCT TCTGCACTTC CCCGTCCTCC GTCGGTGTTA TCAAGTCCCA GATGAACGTC TTGATTTTCT CATCACCCTT GTACACCTGC AGGCAGTAAA GAAGCTGCGA GAATAGAACA ATATTAATGT TAAAGCTTTT GTAAAGTGCA TTCTATAAAC TTTCTGACAT TCATATCAGC GGGTTGAGAA GATAGTTTTA CTCAGCGAAA ACCTTGAGTT TTCTCAATAT TAGCATGGTT GGTCATCATT TTTTTGCACA CGTTTATTTT TGGTTTGAGT TTCATTTAAC TTACTATGAT GCGAGCACAA TCCTCGACGT CTACATCACG CCAACCTCGT TTGAATTGTC CTAACTCCAA AAGTTCCGAC CACCGGCCCC AACTGAAAAA AAAGTATTTA CCAATGAGAT CACGTTTGTT TGTAATATGC CTGGGCAAAG GGATAGACTA GATAGACTTT GTTGTATGTT ACCAATCTAG TCATTGTATA CTTTCCCTTT ATCACCAACA AACCGGTCAA AATACATATA TTTCAAACAA ATTCCATAAA TTATTCCTTA ACGTTACTGG TCTCATGATG AGCACGTCAG GACACAGCCT TAAAACCGAC ACGC