Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT043081
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202042
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 243081
Nearest Genes
Gene Nr FlyBase ID Distance
CG14334 FBgn0038498 8757 bp
Sequence Length 2185
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CACGCCCCCAGTACTTTCCCATTTT
Right Primer CAACGGTGGGGTGCAAATAGGTTCT
Template genomic
Sequence CACGCCCCCA GTACTTTCCC ATTTTCCGCC CACTCAGCGT GCGAGTGTGT GCTAGTGTGC GTGTGTGCCT AGCAATTTCA AAATTGTTGT GTTCAATCAG AGCCGTTTTG CCAGAGACTT CCAGGGACAG CTCGTCGTCA TCAACATCTC TGGAGATAGT GGGGAAAATT CGGGGAGAAA TGCACGGAGA AAGTGAGACG GAGTAGAGTG TAGTCACGTT ATCGATGCTT GAGCAAAGCT TGTTGAACTG CGAGTCCGGC AGTTGATGTC CAAAGTTCAG ATTGCCGGAC TTTTGGTCTG TTTGCCATGC AATCGTGGGG TATGTTTGAT GTTTATTAGA ATCTGTGTCG GTAGCTCTTC AGTGGTGGTC GCATCCCAAA CCGATCGAAC AGGGGACTTT AAAATGTTGC CACAAGTAGT GGAGTTTCTA ATGGAGGAGT TGGGGGAGGA TGGCTTAACC AATTCATTCT TTTAAGAAAT CATCGCGAGA TCTTTATAGA CTACATACCT TAAAAGAAAC GTTTATATCA TTTAGAACTG CCCAACCTCC GAAGTTATGT TTGACCATAT TTTTGTTCCA TTACGTATAA TAATAATTTT CAGTGATTTT TATGCCCCCA AATTGCATTT ATGGCAACAT AATGGTACAA ATCCCATTAG TATTTCATTC CAAAATGTAT GCACAACCCA TTGACCTAAA AACACAGTGG CACTCTGTGA AATATACGCA AAGGTTACAC GCAAAATGCA TAAGAAAGCA CCGAAAACTT TGTGCATAAA TAAGAATTGA GAAACACGGA AAAGGATAGG AAGTTAGGGC AAAAAAAAAA TGTTTGAAAG GAGGCGAGGT CCCAGGTCAG GTCAAAGATA ATAATAATAA AAAACCGCTC AAACATGTTG CCAAAAAAAG AGAAATGAAA ACACAAACAA CAAGAGCAAT AAAGTAGAAA CAAAAGAAAA CACAAGAAAG TGCGAAGGAA GAAACTTGAA ATCTTTCTTC TTGGCCGTTT TCAGAATTTT TTATTTTATT TTGCGTGGAG TTGAGTGAGT TAGCGTTGGC ATTTGTCAGT TGCTAGCTGT CAGCGCTCAC TTCCTGCCAC GCCCCTTTTC GCCACCCCCT ACACCCCCGG GGTGTCCCCT CTTTTTAACC TTTCGGGTAG GGGCAACCCA GAGAGTCTGC AACTTGCCGC AACTTTTAAT AAACTTGGCA AGCATTTTTT CTTTCAACCA TTTTGTTCCG CTGGTTCAAA GGTTACGCGC AAACACACAC ACACCCATAC ACACTCCCTA ATTTATATAG ATACGTAAAA TGGGGCAAGG AAAGGGAAAG AAAAAAACTG TGGCAAAGGG AAAGTTTTAC AACCAAACTC GAATTGAAGC AGTTAAATGC CGTATTGTTT TGCAAAATAC TTGACCGTGG AGTGAGAAGT TTTGACCAAC AAATTGTCAA GTTTTATGCA CGGCCATTTG GCGAGATTTT ATTTTGATGT CTTCTCGTTT TTCATGCGAT TTTTATTGCC TCCCTGCGCG CGTTAGCGTC TTGATCAGGA ATCAGCAAAT GGAAATGGCT ATTGCCATCC TTAGGGATCC TTAAGCAAAG AACCCCGAAG AGAAGCCACA TTATTATTGC TGCCGCTTCT GCATTAGACG CTAATTAGTG GCAGCTACAA AAACAACGCC TCGCAAATTA GTGTTGCATA ACTCCAGGCG CTGCAAGTGA AATATTTGCA CATTTGCGCA AGCAAGCCAC CAAGTTGTTG CAGACACATG CTCGCTGGGG TGTGTGTGTG TGTCCGTCAA ACACGGCGTG CACACCCACA GGCAGACACA TTCAATTTAC ACTCAGAGAA ACGGTGTGCA TCGATGCGAG TAGCTATATA AAATATTCTT TTTGCTGCTT AATAACTCGT CTCATAGAAA TACAAATACT AGCGGCTAAT AGTAATTATT ATTATTTTTT TAATTTTGGA CTAGAGTTAG TACATTTTAC GCTCAGTGCT GCTGTGTGCT TAGTTCCTCC TGCTGATGTG GCAGCCGCTG TTTTGGCGTG TGTGTTTTTG CTTTGCTGCG GTTGAGGCTG CCAAAACTTT CAAATGAGAC CCGCGTGTCG TTGCAATTAT GTTCAAAATA GCATTACACC TTCACCACTA TGAGAACAGT AGAACCTATT TGCACCCCAC CGTTG