Vienna Tile Information
VT ID VT023557
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202023
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 223557
Nearest Genes
Gene Nr FlyBase ID Distance
CG17090 FBgn0035142 6252 bp
Sequence Length 2231
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer ATCTCGAAAATGTACGGGGTACGGG
Right Primer TCACCCCAGAGAGCCATGAATACGA
Template genomic
Sequence ATCTCGAAAA TGTACGGGGT ACGGGTATAG CCAAAAATAT TAGTTTTTGC GATATGAACA TGTTGATTTT GTGTGTGGCA CTTGATTTTC TGGCTGTCAT CGGTTAGATA TTTGTTTATT TCCACACTCT TATCGTTTGT TATGAATTTC TGACAAAAAA AAGTTTTTGG GGATAATTGT TTCAGCTAAT TCTGATACCT CAAAGCATAT AAAGTTTATA CGCCTTGCCT ATCAAGTAGG TGAAAATGTC CGTAGATTTC AGTTCAGCTT TCTTCTCGTG TCTTTTCATT CTGCCCTAAT TAACTTCTCG CTCAGCATTC TCGACTTCAT CTGCGGTTTT TCACATACAT ACACATTTCT GGTTTTTTTC TCTGCCTGTC GATCAGCGGC ATCAAAAAGT TTCCGCTTAC TTTGTTGCCT TTTCATTACT GATAGCCAGC TGCACGTATA CTTTCGCCCA TAAATCTCCG CCGGTTGCTA ATAATTTCAG CCGACTGTGA GCCCTAACCC CGCAGAAGAT TTCGCCACGG ATCACGTTGG TTTTGAGTGG GTGAAAGGAG CTCAGGCAGC TGTGCACCCA GCCCAGTCTT CCTCGGGTCC AGGTCTCCTA TGTCCCCCGT TTCGCCTCTT CTCTATAACC CGCTTTTACC CCTTTCTACG TCTGCCTGTG TAGGCGTTCT TTTTCTTTGC AATTTCACCC GGCTCACACA GATACACACC AACACATGCC CATAACCGGT GCGCCTTGTC TGCTCTCCTT CTCCTGCATT TGACTTTATG CGGGGTATCT CTGTTTTCTG CTTGAGGATG TTACAGCTTT TAAATCTTTA TTCGAATATT TAACAATTGT TTTATCTTTA TCTGATTGAT AATCAGATTA AAGTAAGTAT TAAGAGAGAA TTGTACATTC TCTTATAATG AAGATTTAGT ATGGAACTTC TAAAGCTTAA AGAAAAACCT CTTCACAAGG GTATTTAATA CAACTTGTTA TTAAATCTTT GTCTACTGCT CTTATCTGCT CCCCTTCTTC TTGTTTTGGG CATCTTTAAT AACGAGAATC TTTCACTTTG CCTCGTTGTT TCTGCTGCAG CCTGACACCG TTATTCTATA CTCTAGAGAT GGCAACGTGA GTGTCTGTGT GATGAGTCAA TGTGGGGTAA TCACAATTAA ACAATATTCG TTTATGGAAA ACCAGATGCA CCCGGTTCTC GAAGTTACCT GGATTGGGCT GAGACCTCAC TGGGAACAGG TTCCACCGTC TGGGTTCCCG AAAACAAACA GGTTCCACAT GTCGAACGTG TCCAAAATGG ATTCCCAAAG GGAAATTGGT ACACGCGTGC ATCTCTCATT AAGACTCAGA CGGCTCCCTA TTCTCCGCCC GCCTTTCTTC TCCTTCTCCT CCATTCTTTT GGGCCCCTTT CTCCGCTTCT CTAGCTACTT GCTACTTGGT TATGTGATAC ATTAATGGCG TTTGTGTGTG CGTGCCTCTC GGTGTTCCCT TTTGCGACAC ACAAAATAAA GCCAAAAGCA GCAAAGGTTT CTTCAAAAGC ATTCTACCAA GCCCACGCAC TACAGAAGCC CCAGAGAGCG AAAGAGAGGG AAATACGTCG GTGAGCGAGA CGGGGCACGG GTGGGCAAGC TCACATGTCA ATCAGTCCCT TTCTGACACG TTCTACAATA CGTTGTTTCT GCTGACGAGA GAAGTTCAAT TTAGTTTTAA ATAAATATTT CATATTTTTC CCAGCTCATG ATTCCCTTCA AATCCATTAG AGCTTAAAAA TTAAACTGTG CTTGTATGTA CAATTATTAT TATTATTATT ATGACAATTA TTCATTAAAT TATGTACTTG TAGTGTATTT ATTTTGTGAT TTTAAAATAC CCTTTAAATT CCTGATACTG ATACAAGTTT TTAATTTAAG CAAATGTTGA GTAATTTGCA ATGATATTAT TGTTGATTTG GTTTTTATTT TTGGCCCGAC CGAAAATATA TTTGGCTGCT CGGTTGACAT GTGAGGAAAA GACGAGAAGC AGACCCAAAG AGACATGCGA ACGAGAAATG TAAATGAAAT TTCCATGCAA GACATCACGT AGGCTCAAAG TGCAGATACA ACGAAAACCG AAAGACGGGT AAACAAAATT TAGATTTGGT TTCGGAATGG TTAAATGAGC CAACGACTCC GACCCGCTGC AAATTCATGA ATATACTCGT ATTCATGGCT CTCTGGGGTG A