Vienna Tile Information
VT ID VT017787
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202013
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 217787
Nearest Genes
Gene Nr FlyBase ID Distance
CG8250 FBgn0040505 13102 bp
CG5065 FBgn0034145 14905 bp
Sequence Length 2100
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GGTGAGCACGGATAACATTCGCCT
Right Primer GACCCGATTTCCTACTGACTGGATGG
Template genomic
Sequence GGTGAGCACG GATAACATTC GCCTAATGTG ACCATTATAA TTATACGGAA ATTGTTTTCT GTTTTTGCCT TTTGCTTTCC CCAGAGGGCT GCCTGTGGTA TCCGACTGGC GACCTGCGCA TGAACCGACC CATGAACACG CTGAATTGTA TAGCCAAGCA CTTTTTACCG GCCTACATAC TGGACGGAGT GGCCAGAATC ATGGGCAAGA AGCCATTGTA AGTTCGGCCG GCCCACTACT CCCCCACTAC TACTACTACT ACCATTAATA ACATTTTATA TATGTATATG CATATTACAG CGTTGTCAAC GTACAAAATA AAATTGCCAA AGCTGTGGAA TGCCTCGAGT ACTTTGCCAC ACGCCAATGG CGCTTCAAGG ACGACAACGT ACACGCCCTG CTGCACACGC TAAGTCCCAA GGATCGCGAG ATCTTCGTCT TCGACGTGCG CCACATTAAC TGGGACAAGT ATGTGGAGCG CTACGTTCTG GGCTTCAGGG AGTTCCTGTT CAAGCAGCGA CCCGAATCGC TGCCGGCCAG CAGAAAACGC ATGCTCAGGT GAGAAAATAT ATAATTAACT GGTTGAAAAG GGGAGGTTAT TCAGAAAAGT AAGTAACAAA ATATCCTAAT TTCTACCTTA GGCTCTACTA TCTGCATCAG CTGACCAAAC TGGTGGCGGT GCTGCTCACC TGGCGCTTTT TAATGTCGCG CTCGAAGCGC CTGAATGACT TGTGGAGCTC CTTTCTGGAG AACGCGCTCA GGATGGCGCG CTTGATACCC TTTTTGTAAT TAAATGCGTA TGGCGACCGG TGTGGAAGCT TGGAGACAGC AGCTGCGTAC ATATGTATAT GTGCTGTGAT CTGACGGTAA CTGGCAGGAG CTGTCAGGAT CGGCGAGGAT CCTCTTCTTT GCGATTGCTA AATGCTTTAA CATGGCGTAC ATCTTAGAGG TTTTTAGCAA ATAGTTATAT TCATATTTTT TATATATGTT ACAAATGCAT AAACAGCAGA AGCCCACAAC ACATCCAAAC AACCACGAGA CACAAGGAGC GTCAGTTAAC TAACATTAAA ATATTGACAT TACGCAATGG GGTAACTAAA CTAAATGGCA TCCATCACAT TTATTCAGGT GCAATTATAG GTCACAGGTT GAGAGGGCCC GGTGTCGGTT GTTGTCTCCA CTTATCTCTC TCCTTCTGCG AGATTGTACA ATTTTGTGAA ATAATTTAAA AACGCGCAAG GAGAAAGCCC AAAGTCGAGG AGAATTCCAC AATTTTGCAA ATTGAGATAG AGGATCGAGT GAATTTATTG TCGCGACTCG TCGACGATGA AGCAGTCTGC ATGAATTAGT ACATCCAAAA CTATACGAAA AAAAAAAAAT AGAAATTTGA AAAGACAAAA ACACAAAACC GATTAATTCA GCAATGATTA GTGAGGAGGA TAAATGAAAT TAAATTAAAT GGCTTGTTAT TGCTTTAAAA ATTACATAAA CGTAACGTAA ACTATGCTAA TTAATTAATA TTAATTATAA ATATTATTAC GTAACGAGCG AACATTGCAT ATAAATAATA CGACAAGAGA AAAACCAACA TTATTTATAA TTGAATGTAG TTTTAACATT TTTACATTTA CAATTAAGTT TTCAATTTAT ATAAAACAAA AAGCAGAAGG AGCGGAATTA TATACGTCGG GAGACAAAAT TTGAAATATA CAAAATTCAA TTTATGTATA TGTATATGAA AAAAGCCGAA ACACAAGCAA AAAACTACAA AAAAAATCAT ACCGATAATA AATTAATGAA AACAACAAAT ATATTTATAT ATAAACATCA GAAACATAAT TTCTTAGCAT TTGCAGCCTA AAAACTAAAT CTAAGCGTAG CCAGAAATGG AGTTTCCACA AAATAACAAA CTATGAATGA AGTTTTTTGA GGGAAACGCA ATTAGAGAAT CATGATTATG AAATTTATAT TTGAATGCGA TAAATTGAAA AATAAAACAA AAACAAATAC AGACAAACAA ACTCACACAC ACACACTAAA ACACAGAAAC CAAGACACAT ATAGTAAGAA CATTCCATCC AGTCAGTAGG AAATCGGGTC