Vienna Tile Information
VT ID VT014717
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202008
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 214717
Nearest Genes
Gene Nr FlyBase ID Distance
CG11895 FBgn0024836 17785 bp
CG12934 FBgn0033541 37110 bp
Sequence Length 2102
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TCGCTTAAACCCCCTTTTTCATGCT
Right Primer GTCCGTTGGTAAAAACTGGGGCGA
Template genomic
Sequence TCGCTTAAAC CCCCTTTTTC ATGCTTCCAT TTTCGCATTC CACTTGTAAT CCTTGAAAAA GTCGCTCTGT CATCATCTAG CTTTCTGATA GTTAGGCAAA CAATGTAAAA TTGCAATTAA TTCATGGCCA AATATTTGTT TTGAATTATT TACTCTCACT TCTTTTTTTT TGTTACCGAT TTTAAGGACA AGGGCTTATT TGCATATAGA TTTAATTTCA CGCAGAATGG CAGCAAGTAT CCATGAGCAG CAGTTTCTAT GAGGGATTTT CTCATAATTG CAAATTAATT TGCATTTTAA TTAATTTCTG GTCAAGTCCC AGGAGAATCA AATTGATTGC AAACAAGGGA AAAAAAGAAC GAGAGCCCTG AAAAGCGAAC AAAAGCAATT ATCAAGGAAT ATGAAAAGTG GGAGAGATCA AAAGGAGGCA GATGCTGCAA AAATCAACAA TAGCGCCGAG TACGAAATTT ACAATTGAAT GCGTTTCAGT GGGTAGAGCC AGTGCAGCTA TTGTATTTAT ATGTACATCC TATATACGAT ATGTATGTTT GTACAATATA TAGGCGGATG CCTAAGCAAT TAATGTAATT CGTCTTTGCG CCCGTCGCCT TAATGGCATA CAAATTACGC ATACGCCGCG TGTGCAAATC ACCCAAAAGG GCAAAGCAAC TGGAAGGGGA AGTGGACGTG GAAATGGAAG TGGAAGTGGA AGCTGGGCCA GATTGCTTTA CGCTCCATTT AATTTTCGGT AAATATGCCA ATAAAAATTG TGAAACACGA TGCGGACCCC CAGATGAATA TTTCCTTTTA GGCACCGACA AACGCTCGAC ATGAGAAAAG GTCCTTTTGC CCGGCTTTTC GTGCGTCTCT TTGCATTTTA AATTGCCACA AAAACACACT GGGCAGCCAT CTAACTGCTT TCGGACTAAG CGAATATTTC GTTTAATTAA AGCTGACCCA GTGCCCATCA GGTGAAGGTA ATTGGCCAGG ACTAGGACCT CTGTGAGGCA CATTAGTTGG CAGGAGCTCG TCATACCCGT GTGTCCTCTG CCCGGAGATG TGCCGCATAA AAGTCGATTT TAATGTGAAT TTCGTGTCGC ACAAAACGAA ATAAATTTCA ATAAATTTGC CAACGCAAAA GTGGGCGGGA ATGTTCTAAT AACTTTTAAT TAGTTAACCA TGTGGAAGTT TTCGCTGGCA AACTAAAAGC AAATTTGCTG TCAGCGCTAT TTGGTTTTGC TCTTTGGCTG CTGCGGCAGG TCGACAAGTG AATTATTAAC GCCTGACAGG TAAAACCCGA CGCCTTGTGC CCGTATATAT GTATATTCAT AAACCCCCTT GATTTCAACC CGCAGGCAGG AATTTTTCGC CTGCCAGCTT AAGCGTTATA ATTAACTGCG ACACAAACAT TTTCGGCTCC CAGTTTGTGC CTTATTTCCG AGCAGTGGGA ATATATTTTT GCGGCTCAGG CTAAACCAAT TTGCCAGGAC TTAATTTTTA AGCATTATTA ATGGTTTTGC GGCGGGACGG GTGGGCAGAT AATGCGGATT CTGGTGGTGG GTGGAAAAAT GCCGAGTCTT CGGTGGAGTA ATCACCGGAA ATCTTGGACT GCCGTCGAGC GTGGGTCAAC AAAGCATAAT TTTAGTGGTT GACTGCGGCC ATATTTATAT TTCAATCATC CCCCATTTCA GGTCTTCGAT GCATGTGTCA CAGATATATA ATAGATATTT TCAATTTTAT TAAATACGTA TTGGAAAAAA CTGTTCGTTT TCGACTCATA AAGCAATTTA ATGGTAAAAT ATAAAATTGT TTCAAATTTA CATGTCTTGC TTTTTCGCCC TGCTCGATTC ATGGCATATG CATAATAATA ACTTCATATT TAGTTAGTTT TTTCATCCAA AATTTTAGTT TGCTGTACTT CACCCAACAA ATTCAAAGCT GACGTATTCT GAAAATCGAC GGGCTCTAGA CTCTAGTCAA GTGTGCCATA GCCAATGAGC TCGTGACATG AGCAAGCGAT TAAGGGATAT AAGTAAAAGC ATCTGACATT TGCTAGCTGA ACTGCATGGC ACTCAGACTC GCCCCAGTTT TTACCAACGG AC