Vienna Tile Information
VT ID VT004435
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 202002
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 204435
Nearest Genes
Gene Nr FlyBase ID Distance
CG18024 FBgn0029123 8915 bp
CG9468 FBgn0032069 33346 bp
Sequence Length 2116
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer TGCAACTCAACAGGACTCGGGATAA
Right Primer TTGGACTGGAAACTTATGTACACACCGA
Template genomic
Sequence TGCAACTCAA CAGGACTCGG GATAAGTTGC TGGTAGTTCG TAATTATTTT TTCATTTTCC AACCATGAAA TCGATGCAAA GTAAACCAAT CCCAGTCGAA CGAAATTGGC TCCACGCCAC TGCTTGTTTT AGCCCCTCCC TGTAATTAGC TGAGCAACTG GGCTTTAATC AAGCAGAAAA TTGGAACGCT TCGGTTCTGG CAATTAGAAG TGGTCAAATG CAAAGCACAA ATAGTGGCAG CAGCAGCGAA ATGCGAGCAA AGTATATATT CCAGCACAAA TTGTAGCTCA CAAAACACAA AGTTACCGCT CCGAATGGCA AACAAAACAA ATGCCGAGCT CAGCGCAAAT TTCATCAGCC TGCCGAACTT TTGCCTTTGT TCGAGGTGGA TTATTGGTGG TGTCAATTGC CAGTGGCCAT TTCAATTCTG TTCTTTTTTC TCCCTTTTTA TTTTATACAT ATTTTTTTTT GGTAATTTAC GCCCTCGTCC TGGGATCCTT GGCATCTCCA CCGCCATCTG CTCCACCATT CCCACTTTAA CGAGTAATTT CAAGTTTCAA GACTCTGGCC GCCTTTGAAT GCAAATGCTG ATGATGCATT TCCTTTCAGT CGGATGCCGA AACTGCTGAG AGCAGCAGAT TGGAAATGGC TCCTACAAGA TGCATATACA TATACCCGTA CTCATCCATA TTGGCTGTGC CGCACGTACA TATATATCCG ATTTGTATTA TTTGTCTTGC AAGTTAATTG AATAAAATGC CAAATGGCGA ATGGCGAATG GTGGAATCCA AGTGCGACAA ATTCAGCTGC CCTGGCTTTT TATTTTAGAG ACATTCCGTT TCATTGACCG ACGTGGAGCG ACGACAACGA CAAATTGTCA GCCATATTAA TAACATCCCC GAGGTGGAGC ACAGTCCACA CCCGAGTCAT TGTTCCCATG GCCAAGCGGA GCTCTCATTG TCCGCACTTT CAGTTACTTG TAACAGCATT TCAATGGCGA CGACAGCGGC TTGCTTATTA CTTGTAACTC GCAGACTGCT CGCAGAAGGC ACCGCAGCAG CATCCATAGT CCCCATCTCT ACCTTCATCT CCATCCAGAT CCACTCCCGA TCCCCCTGTA ATCCAGGTCC AGCCAAAGGA ATACCACATG CTCTGCGGTC AGCAAGTTCT TTGTTCCCTC CAAGTGCGTG CTCGCATCTG AAAGGCGGAG AAGTACGAGT GCTACAGTCA TCTATCCACA TTGAATGCCC ATTTACAGTG GCCCTTGAAT CTGAATGCCA TTCCCAGCTA GGATGTACGA ATCAAACTTG GTTTATAAGC TGTTGTATTT ACCCACTAAT AAAGTATATC ACTATGATAG CTTTATATAT TTTAAAAAAT ATTTTTTAAA CCACATGAAC GCTTTAGAGA AACACCTTTC TATCCGAATT CTTTCCATAG TTCGGATGAC CCCTGCCTAA TTTATGTTTG ACTAATCTCA CACTCAGCCA GTCCAGTTTT AGTCCGCCCC AGGTCGAACA AGATCCAGCT ATTCGACTGT CCGATAACGA AGATTCTCAT AATTTATGCC CCAATCACTG TCCACTTTTG TTTGCCTCCC CGAAAGGAAT TGGGAGTTGG ATTTTGGTGT GTGGTGGTGG CGTGAAGTTG CCTAATTATG AATTAATTTC CTAAGATATT AGCAAAATAT TTGAATTTCT CGGGAGTAAT TTATTACGGC CATTAGGAGC TCTTTCTGAT GCGCTTGGTT TTTTCTTGTC TTGGACTGCT CAAAGTGTTT TAAAAGAATT TCTCGGCTCG TTATTCTCGT ATTTTATTTT CAGTGAATAA AGACATAAGC GAAATTATTA ATATGTGTCG CCATGTGGCA GCCAAATGAA TTCATAGTTC ATTGATATTA ATATAAATTT ATCGCAGAGG AGATATTTGA ATTTTTCTAT CTCGAGTTTG GTTCGTGTTG AAAACAATTA ATGTGACAGG CTCTCCCATA TCATTGGATA TTTATTGGAA GCTAACTTCA TACTTTTTGC ATTTTTAATC ACAACCTCTG TCTAAGTTAT GCGAAATCTT CGAATATCCA CTGGCCCATC GGTGTGTACA TAAGTTTCCA GTCCAA