Vienna Tile Information
VT ID VT044108
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201988
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 244108
Nearest Genes
Gene Nr FlyBase ID Distance
CG3619 FBgn0000463 7919 bp
Sequence Length 2111
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TCCGAGCTAATGGAAAGCTCCCTAGA
Right Primer AAAGTCATGGTCCGAAAAAGGGGGA
Template genomic
Sequence TCCGAGCTAA TGGAAAGCTC CCTAGAGCTC CATCGCCCCC ACAGTGAGCA CTCATTATAA GGAGATTATG ACAGGCGGCT AGGCAAGTTG GTCGCCCACA CGATACCCCA AACGCCCGAA TGCCTCCCCG GACCGCCGAA TCTAATGCAA TGCGAATGCA TTTCAAATGC AAATCGGCAA AATGCAACTT CGAATGCAAC CGGCAGGCAG CGCCCTCAAT TCACACTTGA TTTCAAATGC AGCGCTGCTG GAAAAACCGG CAGAGATGAC ACAAAATCCA AATCCGAATC CAAAGCAAGG CGAAAACCAG CCGATTGAAA CTTTTGCAGA GGTGTCTCTA CTGCTACTAC TGCTGGCTGC AGCGCTTGGT TTTCCATGGG TGTGTGTTTT TTCTTGGCTT GCGTAGAGCT ACGAGTTTGG AGCTCCGCGT TTCGATTCGC TTGTAAATGA CTAATTTTTC GACCAACTTT CGATTTTGCG TGGGCCTAGG GCAACCGGAG ATGTAGAATT CATTTGGTTG ATAAGCCACA GTTGCCGATT GATTGCATAA CGATTACATT GCCATTTGGT TTTTGTGTGC TTGTCGTAAT CAGACATTGA AATTGCGCTC TGCGCGAATC TCTTCTTTTT GTCGCTGCGA ATAAACGTAA AATTTATATG GGCACGACAG GAAGCAAATC AGACATAGAT GATCGGCTTT AACCAGCGGC ATACAATGGG AAATGAGCAG GAAAGGTAAT AACAAACGAA TGGCTAAAAT GAAATGAAGC GCTGCGATGG TTTATTGGTT TTATTGTGCA GAGAAATAAA GTTTTCAACA GTGGCTACGT GCTGGCCCCG CTCGTCTGAA TGAAGTTTCC CATTATTATG TGAATTTTTA CAAGTCCAAT TTATGGAGCT TTAGTTGAGG ATCTCAAGTT GGATGCTATT CTTTAGTTCT GGCGAATATT TGGTGTATGA ATCTATAGGA AAGTCCCTCT ATTTCACTTC CCTTAGTGGG CATATATAGC GTATAAATTG CGAGTACCTA TAGACACTCG CTGCACTGGC GTATGCCACA TCCAAAAATA AATGAGGCAA CATGCATCAG CGGCCGCTTA GTGAATATCG CGTGCGTCGG TGCTGTATAT CAACGTCAAT ATCCAGCATA TAGCATACAG AATGTAGCAT AGGGATATCT GGATAGGGTG AAGTGCACGG CGGCAGGAGT AGGAGTGGTA GCCAGACACG TAGCAACAGC CACAGGGGGA CTGACTGACT CTCAGAAGAC ACAGCCCGAA GACCCAATAC TCAAGACCGA AGACGCAAGA CGCAAGGCAC AAGACAAGAC AGTACAGCCC GTCAGACGGG GGACAAAAGT AGCAAAGTTC AATACGAACA AGAGGAGCAT GAATGCTGCC TGCCATCGCT TGACTATTTT TAGTCGCTGG GCGGGCGAAG GGCGGAAAGG GGGAGTGGCA GCCCCCTATC CCTACATGCA ACATCGGTTG CTATATCTTC TGGCGTGTCG TCAGGCATGC GTGGCTCGTC TTTCGTTGTT TTAATTAAGT GCAACATTAA ATTAGTTGGT GCAGCAGCGG CAGCAGACAG AGTCATACTA TAATTAAATT TATAGTTTGA CCTAGAAATG TTTTGAAGTT GAAAGTGCGC GGAAACGGAC CGAAATAAAG TCTAGAACGC TCTAGGAGCA CCGATTGAAA CAGCAAACTA ATTTTAGAGG GCAAAACAAA GGATTGAAGT TCTTGCCCCA GTAAAGATAA AATAGATCAC AAGAAGCAAT TTACCAAAAT AAAGTCTAGC ATTTTCTTGA AAAGTCTAAA AATAAAAAAC ACTCCAAAAA ACATTGACGA TAGAATGCGA CGTGAATTTC CCTTTTCACT ATATTTAACT TATACCGAAG ATCAACAATT TGGCGCGTGC GTTTTAACTT AATTATGCTA GCCCATAGTT CGCTAATTGT TTATTTATGC CTGCCCGCAG CTTAATCGCT AAAAATGTAT TCAGCTTACA CATTTCACGT GCCAAAACAT CTTTCGCTAC CTGGCCCGGT GGTAATAGCC CCCTCCCCAC CCTTTCCCTA GCTTCCTCCC CCTTTTTCGG ACCATGACTT T