Vienna Tile Information
VT ID VT043788
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201986
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 243788
Nearest Genes
Gene Nr FlyBase ID Distance
CG12345 FBgn0000303 1582 bp
CG32848 FBgn0015323 1653 bp
Sequence Length 2075
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TAGTCTGCAGAAACCTCCATCGGCA
Right Primer TGGCTAAGACACGTTCCCGAGCAAT
Template genomic
Sequence TAGTCTGCAG AAACCTCCAT CGGCATTTAA TGCCCAAATT CCTCTGCTGG TCGTTGTTCT AGGACTTTTC TGCGGTCACC AATTGAGAAT CAATTAGCCG AGAATCGCAA ACAAATGCCT TTATTAGATT TCGTTGGCTA ATCAAATTTG TGTCTGCTGT CCCATTAAAT CATTAAGATC CTCGTCTGGT GGAATGTGTA GATGGTCTAG TCGTGGTCCG GCTGAAGTTC ATTAAGGCTG ATACTACCAC TACCACTACT GTCATCCATG GGCCAGAGGA GACGCCACCA TGCCGAAAGC CACCTGCCAG AGGAAGCAAT TTTCTCTGGT GCTGCGGCTG CTGCATAATG AAGGCAATAA ATATAAATTT CACACACAAA CACAAACAAG ACGACGCCGT CGTCATTAGA TTGTTTGCCT TGTAGACGCG TTTGTAACGC TGATGTGTTC ATAGCGGTTT CGTGTCAAAA CAAAAGGGGG CGCACCACCA CCCAGTCACC ACCACCACCA GAAACCACCG AGAAACTACA GACCGAGTTT CTCCTTCCTT ATTTTCTACC CATCTACGGC AGCCCGAGGG GATGGAAAAA TGCCAGAAAC AAAGGCTGGC AGGAAGGTAG CTCGTAATAA GCTAAACGAG AAACAAGTAA CGCATTTGTC TTGATGCCGT CTGATAAGAA CGCGCCCGTA CATCTCGAGG GTTGCCCGCT CGGCATTGAG CCATCAGGAT TCAGGAAGGG GGACAATGCG GCAAGGGGCT GGCGGATGAA AGGGAAGAAA GGGGGAGAAA GAAGCTGGAG CTGGATCTGG ACCAGAAGTT GCACCCAAAT AGCGCCATCA AAAGTCGTAA ACGGGTCGCT CTGATGGTGT TGTTGATTGC TCCGCATTTG CCAAGCTACA AATGGTTACA TTTTAGGCCC TGGGTTCGAT GCTGGAAATT AGCAATTTGC CAGGACGAAT ACGATATCGC AGTTATTAAT AAAAAATGCA CGTAGAGAAA AATTGGGTGT ACTCGTATAT AAAAGCAAAA TATACTCTCG AGCGTGAACT ACTAATCTCA CACGAGTTAA ACTATATGAA TAAAAAAAAT TGTCAACAGC TTCATGTTTT GGAATCATAC TTTCTAGTGG CTTGCAGTTG TAATTTAAAA TAGTTGGAAA TTGTTAGATG TCTGAGGAAT CATCTTCTGT CTATTGTTCT CTGTGCACAA AACTACTTGA AACACGAACT GCTGAATGGG AGACATAAAG GTAAATTACT TTTACCCTGC AAAAAAAAAG GCATTGAGTG CGGCAAGTCC GAGTAATTTA TGTGGAAATC AATTTGTAAT CCAACGCTCA CAGTTGACCA AAAAAGGGAT GTTCGGTGGA AACTGGACAT GTGTGCAAAA ACACGGACAT TAGACACGCA CACCCACACG GGGAAGATCG AGAAAGAGGA AACCATTTGG AGCTCACTCC CCCCCAATAG CCCCGCCCAT TTAATGTTTT GATTTATAGA CAGACCCCAT CCACTCCTCC GCACTAAAGG AGCTGCTCCA TACGCCCCGT GGTACCATCA GTGCCACCTA AATGACGCCC TTTGTGCGCT CGTGCTCCTT TATTTCCATT TCGGGGCAGC TGGAAACTGG AGTACGGATC CTCGGGCTAA GTGGCTGCGT GTCCACTGGG AGTTGATAAA AGCACATCAG CGCGGCAACA ATAAGAGCAA TAAAAACAAG GACCTGCAGC ACAGAGGGTT GCTTACAAAG GCACAAAGGG ATAGATACCC TGTTTAAATT GACATTTTCC ATCGTCCCAA AAACTTTGGC AATTAAAAAA GTGCTTTACA ACGACTAGCC GAGCTAAGGC CAACCGGGTA AAATCGATTG TACACGAATC GCAAGACCGC GACAAGACAA TTAAACTTGA AACAGAAATG TCACTTGGCA GTCGAGTAAA CACTTGGCAG TCGGAAGAGG GTTAAGGTAA CGCTAGCAAC GCTGGCCAAG TTAATCGATC AAGAGTGGCC AAGGTGAGGC TCATTAGCTG GTCACAGTTC ATTAGAGCCA ATTGCTCGGG AACGTGTCTT AGCCA