Vienna Tile Information
VT ID VT026700
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201964
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 226700
Nearest Genes
Gene Nr FlyBase ID Distance
CG10118 FBgn0005626 3466 bp
Sequence Length 2213
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer CTTGCTGGGGACTTCCGAGAATACG
Right Primer AAACCCATCGGCACCAAAAGTTGTC
Template genomic
Sequence CTTGCTGGGG ACTTCCGAGA ATACGGATCT GTGGTAGGAC TGTACCGGCA CTTCCTAGGG GGGCAAATAA ATATTATTCA TAATTCAATT AAACGCAATT AATAAATACA ATTAAGAGTC CATTTCAAAA ATTCTCAATT CTGTTTTTAT TTTGTTTTTT TTTTTTTTTT TGTATTTTTT ACTCCATTCT AGCGAGCTAC ATTCTACGGC AGCAATCTGG CGCGGCAATT ATGTGCATTA ATTACGAGTG GCAATCATTT TTGTTGCTAA TTATTGTATA ATATTGAGGT TTTGCTTTCC CAAATCGAAG TCGGCTAGTA TTATTCCACG GCGATGAGCT GTCGAAAAGG GGAGTCCACT TCCACCACTT GACGATGATA TGTCAATCAC GTGCTGTGGA AACCGAAGAT CGCTGTCGGG GGAATCTCCG CTCCTCCGCT TTCCAAGATC AACTCGTTTG GGTGCTGAAT CACACTTTGG GCCAAAGATG ACGCCGGCTA ACTGATGCTG TGTTTTTATT GCCCGCATTT AGCCGTAAAA TTGTTGAATA TGCAAAATAG CCGCGCGCCT CGTTCGCATT TCGTATTTTG TTTGTTTTGG TTTTGGACAT TTTTTGTTTG TTTTTTCTGT TTGTTTTTCA GTTTATTTTA CGTCACGTGC TGCAAACCAA AAACATGCTC AAAAAAATCC CAGAGTCACT GCAGCATAAC GCAAGTTTAA GTTTGGGGGA TTTTGTTTTT CAAAGGATAC GCTGATGAGT GTGGCAGTAA ACAAATTACT CTGATAATTG ATACTGATTG TAGAATTCGC TAGAATGGAA ACTATTCAGG TGAATGGGAA TTTTTACAAA TTATTATGGC AGATTGAGTG CGCTTTATAA AATTATCTCG ATGAGTCTGG AATGCTAAAC TAACTACTCA TTAAATTAAA TAAGTCATTT AGCAGTACTG CAAATTGATG ATGAATTCTG TTTTCCGGAT GAGTGCGAGA AGGCCGTTCG TTCGAATGGT CAAGGGATGT TACGAATTCT GGCCAGGATT GCAGCTCGTG TTCCCTGCTG TCAATCACAG ATTTATATTT AGCTTATCGC CGTTGATTTT AACGACTTTG CCTTACTTAA ACGTGAATGT GTTCCAAAAC ATTACCAAGG CGTGTTCACG CAGTGGAGCA GAAATAAACA CCAACTTAAT CACCATGTTT ATCGGAACGA GCCCCCAAAA ATAATCGGTA AAAAGTAGCT TTTCTCAGGT ATGTACGAGT ATATTTTCAT TATTATCACA TTGTCGTAAA AAATTCGGCT AAAGTTGAAC AAAGCGCTGT GTTCAATCTA AACCAGTTTG TTGCACCTTG TCAACTATAC CACACAAAGA AAGTTAAAAT TAAAGCCAAA GGAGCACGGA AGATTTTGCA CTCGTTTACG CATGGATATA TAGGAATTTA ATTTAATATA TAACCATGTA TGGTGCCGAT GAAATGGTGC CAGTGACAAG CCCTTTTGGC CACTTGAAAA TGTTGTTTTT TCTTCTCCCA CCTGCCAAAC ACTCTTGACC CGCTTAGCAA AAGGGGGTGG GTCGGCTCAA AAATCAATAG ACACCTGTTG ATGACAGTTG AGACTCGAAC AAAAACCGAA ATCGGAAGCC CACCTCCACA GCCTTTTCAT TTCACAAGTG CCTGTCTCTG GTTTTGATTC GCTTGCACAT ATGTAAATCA CACAAAGTTC TGTTTAAAGA GGTGGATTCC CCCAGATGCC AGGTGCGGCA ATTAAGCGGA AAAGGAGTCA CATGCTAATT GATGGCTCTG TCTGTGCCAC AAAATCCAGT TAGCTGACTC GACTTGGTCT TCCCCAACGC ACTTGCGTCA AGACCGAATG TTGCTGCTGC TGCCGCTGTT TATACTACGG CTATCTGAGT CATGGTCATG AGTGTCAGTT GATACTTTCG AAAGGTGGTT ATTTTTCCCA GTTACAAGGG GTTTTTTTCT CGAGATCAGT ATTCTGTTTT GGTTCTGGCA CTTTTTTGTG CTAAATGTCA CATCGGAAAT GCTGCGGTCA ATCTAGCAAG GAAGAGATAT CATCTTTTGG TCTGGGTTTT CTGGGGGATT TGCATAATTC TTCGCCGGGT TATTTCCTAG GAAACGTTCT ATTTACGAGT GTTTTCACAA TGGTAAGCAA TCGCTAATCG AATGATTTGA CAACTTTTGG TGCCGATGGG TTT