Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000129
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status unverified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201857
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200129
Nearest Genes
Gene Nr FlyBase ID Distance
CG11601 FBgn0031244 0 bp
CG3625 FBgn0031245 7561 bp
Sequence Length 209
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TTTCATTCCAGCAAGGAGGCGTTTT
Right Primer TCAACGCCATCTTTGAATACCACTGTT
Template genomic
Sequence TTTCATTCCA GCAAGGAGGC GTTTTTAAGC TAGAACTAGC TTTTTAAAGC CAAATCGATA TGATAGCGCC ACTTGACGTT TCTCTGATCT TGAAAAGCAG TTTATTCCAA GCTTCCCACC TTAAAACAGT TTTCGCAGCT GATGAAGAGT TTAATCGCTT TATTATGGTA CTAGAATTGA ATAACAGTGG TATTCAAAGA TGGCGTTGA