Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000104
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201755
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200104
Nearest Genes
Gene Nr FlyBase ID Distance
CG3696 FBgn0086902 20490 bp
Sequence Length 2231
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CATTTTCGCTTTCCGTTTTGTCGTTG
Right Primer TGATTGAAGCAATGATCAGTGGGCG
Template genomic
Sequence CATTTTCGCT TTCCGTTTTG TCGTTGCCGC CGCTAGCATT TTCACTGCTA CTCTTACCAG ACGAACTGGG ACGCTCCGGG TCGAGAAGCG AGTCCTTGTT ATCGCCCCCG GTGAGTTTAG TAGAGTCAGA GTCTTTGGTC GTTGTAGTTC CGTCATCGTC CACCTCGTCA CCATCATCGT GCTTCGAATT AGCATCGTCT TCGTTTCTGT GGTGGTTCCA GAAAAAAGGG TTTGAATGTT AGTAGCAATT TAATGGAATT TACTGATCAT ATATCAGATG CAGGCCATGC CCAACGCAGT TAAAACACTG AGAGAAAATT CACAAAACAC ACGCACACAC ACACATTCAG CGCAATGTCA ATGGATCAAT GCATTCAATG TGAGCGTTAA TGGAAGCCCC GTAGGTTGCG CTGTTGTATC TGAGAATATT TCGTTGAATA CCTTATCAAG AAATTATACG GCGAGAATTC GATGAACAAG CACAATGATT ATTAAAATTA TTAATGTGAA TTGAAAGTAC TTTTTTAATT TGATTTGAAT AATTTAAATT AAATCTAGTC TATATTAAAA GTCAACAAAA CAATTATTAT GATTTATGAC CTTAACATTT GATGGATAAA TAGCACTGTC TACCAAACTG TAATCTTTGA TGTAATATTA TATTAAGCGC TAATAGCTGA AAAAATGTTT GAAGCACATT TTAATGCCAA GACTTTCAGA TGAATGCATG TGCACGTGGG GAATGGGAAT GAAAATGAGT TTAAGCAAAT CCTGCACGTT CCTTCCATTC AGGTCTAATT GGAAGCGTAT TTATTTATTT TTTTAATTTT AATACTTTAG TGTGATGTAT ATGAATTACT CAATGGCGTT TATGTATGGT TTATATCTCT TTGCATCTGT TGTTTTTTCT ATCCGGCGTG TTCAAAAAAA CCTCTATATC ATTTCTCAAA TTCTTTCACC ACAGTAGCGG TTAAAACGGT TATCAATTAC CATCAATATT AATGTTACGT GTGTGCAGAA GGTACACGTT GAAATAGAGA TTCCTTAGAA CACACCGAAT TAATTTAGAA TTGATTGTTT TCGTTTTGAA GACTTACATC GGCAAACTCG TGACAGCCAG ATCGTCACCG GCCGCACCGG CGCCCACATG GGTGACAAAG CACAGATTGG GATCGGCGCG CATTTGACGA TACATTTCAC AGCCATGCTT GTAGGTTCCC ACCAACAGGC TCTTATCACA ACAAATGGGA TTCCACCATG AAGATGGCAC TTGATCTGGC GTTGGCGGCG GGCGAATGGG GAGTTCGCTA CATATGATCG TATCGTTCGA TGAGTACATT CGATAACATT CAAATGTGTT TGGTGGATTG GGGAAGTTGA GAGATGCGCG AAAAAAGAAA TGCGTTGTTT AGTAAAAATT CAATTTTCTC GGTTCAACAA TTTTTTGTAT GATGTTAAAT AAAACAAAAA TCAAAAATGA GACCATAAAG GGAAATAAAG TAAAAATTGT AACATTGTTA ATTGCCAATT TGTACTACAG ATTTACCACT ACAAAATGCA GAATCATACA AAGCAAAATT TAAAAGGTTA GTTGAGCCTC TTGATGGCTT TTTTTTTTTG AATTTGGTAT TCGTATTAAA AAATATAAAT TAATTATTGA ATTGCATGTA TAACTTGGCG GTTTTTGTAT TATGAGGACG ACTGCACGTA TGGAGGTTAA TAAAGATGTT GAGTAGCGTG AATTTCCCTA TTCGCCAGCT TTTTTCTTAA AAGTGGAAAA CACCGTGCGT GCAAGCGAGG GCGACGAGCG ATGGCGATCG ATATCGGTGG TTGAGGAATA TATGGGGATA TTACCTTTCC AAATTCAGAT TCAGTGCCAA CTGCTGCTTG GCCCTCGTAC TGCTGCAGTT TTTGGTGGTT ATATAATATA CGTATAGATA TCGCAATGAG GTCAATTAGG AATTTTTAAG GTTTGTTAAA CGAATCGAAA AGATACAAAA CACAGCGATA GAAGAAGATT CGATACGCCG AAGATTAGTT GGCAAAATAT AGAATTTAAA TGTTGTGGTT ACAAATGAGC AGAATCGTGT ATAAGATGTA CAAGTGTTAG CATTTTAATG GACAAGCAAT CGAAAATACA AAGAGAGTTG CAGTATAGAG ATACATAGCG AATAAAAGAG AATCACATTC CACCTGAACC TTGAAACGCC CACTGATCAT TGCTTCAATC A