Vienna Tile Information
VT ID VT018684
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201716
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 218684
Nearest Genes
Gene Nr FlyBase ID Distance
CG14503 FBgn0040737 26765 bp
CG15066 FBgn0034328 42505 bp
Sequence Length 2143
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer AGGCAAGACCCTCCTCTCTACTGGG
Right Primer ACAAGCTTGAGGTCAAGTACTTTTGTTTAACG
Template genomic
Sequence AGGCAAGACC CTCCTCTCTA CTGGGTCCCC CCTTCTCTGC TTGTCTGTAT GCAAGACCTG TTTCATTATA ATTATGACCC TCATCAAAAA TATTTGACTC AAGCGGTTTG TTTCCCTCTC CCTTCGGTCG AAAAGAAAAA AAAGAACGTA CGACCCTTTT TTTTGCTTCA TAATTTCATT GAGGATAATT TGAAAATGTG CTGCTACGCC ATGGAACGGT ACGTTGGTCC CCCTGACTTC GCAACAACCC CGTTTTCCTT GTCGGCCGAG GAAAATATCT TCTTTAGATT TTTATGGTGA AAAGCGATTA CGCAGCAGCG CAGCAGAAGC GACGGAAAAG TGCCAAAATA ACGATTAACA GAGGGGGGGG GAGGGGAGAG AGTGGGCTAG AGCTTAAGGG TTGCTCAGCA TATATTCCAG ATCCCCGCAG CTATTTCCAT TTTCTTCGAA TTTATGAGGG TTGCTCCGTC AGTCAGTCCG TCTGTCTGTC TGTCTGTGCA TAAGTAATGA ATGCGAAATG CCGGGCAAAT TTGACTTTCC CCCTTGGGAT GTTTGCGCAC GCTTTTGATT GACTGGATTT TTTTTTTTTT TTTTGGGATA AATGCATAGA AGGTCGGGGA TATGGCAGTG CTACAATCGC CACAAAGGGC AGCTGCACAT TAGAGGCAAA TTCGGGTATC GGGCAGCAGG AAGTTGGCGA TGCGGTTGCC GTAATCAACG ACAAAAGCTA CAACAACAAC AACAACAACA GCGGATTTGT AACATTTCCT GGTATCCTGG GATTATGGAA CGAAATTATA GTGAACGAGG CAAAACAAAA ATGGCAAGGG AATCTTCTAA ATGCCACGCG TGTTTCCCAT CATTGTTTGC AGTTCTGTGC ACACATTTGT CCCCTCTCTC TCTCTCGAGA AAATTTGCAA ATTAAATGAT CCCATTGGAC GGGGCCAGGA AGCTTATCCA TTCAAAAAAA AAAAAAACAT TCTGTTCGCC AGGGGCAAGT GGATATATCC TGTATTTGGT CAGGACTTGA TCCGTTTTGG TTTGCAGCTT CAACGCCCAA AGGCAAAAAT GTTTCGTGGT TAGCAAAATG CTTAGTCAAC CGTGTGTCAG CAAAATGTTG AAAAATCCCA AAGAGACTAG ATTAGACAAT AGAATATTTT CTTTTGAAAG GTTATTGCGC TTAGTCCGTT TTTACTTTGC TCTAAAAATG CAACTTAATC ACACTGATAA ATTTGCTTGA CTGCGTGTGT TTCACACTCT GTTTGTGTCG TTTATACGTC AAATACAATT AGGTTGCCTG TGAGTAAATA AATCTGAGAA TGTTGCCAGT TCTGCGCATC CTATTACCTC AGGAATATCC TATACTTTGC CTCCCAAGGA CCCTCTTTTC TCTCATTACC TTCCTCTTTT TTTCCTCTTC CATTGAGTGC GACTCTGTAT GTGTCCTTTG CACACGTTCC ACATTCACTT GGAATAAAAA AGGAGGAACT CGACATGTGA ACAACAATAT TATCCAGTCC TCCCCTCGCT CCTGGTTGCA CCCCATCCAT TTCGTGTCCC TATCCCTATT CCTAGACCTA TCCCTTCCAT GTCTTTGTTT TTGTTTGCCT TGCTGAGTTC CCCTCGGGTT ACTTCGAGCG TGTAATGTAT GCTTTTCATG TGTTTTTTTT CTTTCTTTTT TTTTTCTTCT GTATGCCATT GTTTAGCACG GAGTTTCGTT CTGCTTCCTT TTTTTCCCCG TCTTTTTGTC CTGCCGAGCA AATAGGGATC GTTTAGGAGA ATCAACAGCA GGCACCGACA AACTGACGAC GACGTGATGT CCTTGCCATG CAAAACATTT TGGCAACACA CACACACACT CCCAATTTAA AAGTTACGAT GGATGTGGAG AATGAGGTTG TTAATTTTGT ATAGCTTTTT GTCCCTCAGG ACTTTGTCTG TTCTCATACA GCTTTGGTGA CTAAATTGAA AAAAGGACAC AAAACCAGAC GAGTTCTGCC TCATATCGAA TTCTACAAAG AGATATCTCG TATAATAGAA ATTAAATTAA TTTGAGAGTA TTCTTTAACT AATGTTTTAT GTGCGAGAAC AACACTTTTA ATGTAAAATG ACGTTAAACA AAAGTACTTG ACCTCAAGCT TGT