Vienna Tile Information
VT ID VT026477
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201689
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 226477
Nearest Genes
Gene Nr FlyBase ID Distance
CG10160 FBgn0001258 17980 bp
CG32401 FBgn0041625 37677 bp
Sequence Length 2264
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCAGGAAGTAAGCGACCTACAAGCG
Right Primer GGAACCCAACCCAAATCACACTCACA
Template genomic
Sequence CCAGGAAGTA AGCGACCTAC AAGCGTTTGT TTGGGACTTT CCAGGAATTT TCGAGGCGTA GCAACTGTTT GTGACATGTT TTGATTTGTG TTGTCGACGT TTACGAGCTT GTAACTCTTC TTGGGACCCT GGACCTGGGC CAAAAGCCAG GGGAGAGAGT CCAAGTCCAG AACCGAGACA TAGGTATCCA TCCCAGGGAC CCCACAAACT TGGTTGGATC GCCGCCACTC ACTCGACACA GAATCGAAAT GTTATCGATG ACATTAATAG CGATTGGGGG CTTTCATCAA TTACATGCCT TTGTTGGCCA AGCCAGTTGG CCAAGCGGGC TAACATCCAG ATCGTTACAG CCAACTTAGT ACTGATCGGC CTACGCAGCG AAATTGTAAA TTATTACAAT GCAAATGATT TCCATATTGT AAATATGATG TGAGTGCTGA TAAAGCAGCG GGGCTGGCAA AAGGGAACCG CCTCTGCCTG TTGGCCAAGT TTATGCAAAC AAAAGTTCAA CGCATTCAAA GTCAAGGCAA GAGTCGTTTC AGAGCAGTTA AAGTAATTTT GTGAGTACCG TTTTGGGCCC GGATCTTGGC CTGACTTTGG GCTCGGGCTC GAGTTCGGGG GTTTGGGTTT GAGTTTGGGC TTAGCTATGG GTTTCGGTTT CCTTTGGCTG CCTTGACCAC CACCAACGTC GCCGGCAATC AAGTCAACTC CGCGCCGAAC TGTATTAACT CTTCTGTCTC TTCTGGACGG GGCCACAGCC ACAGCCACAG CCATAGCCAA AGCCAAGCCA ACTGTTGCTC TTTTGGCCAA GTTGTGCCGT CTGCTGTCAG TTGGCATCTT CCTGTTTGCA CAAAACGTCA CGTTCGAGTC ACGTTTCCAA CTGCCATCAA TGGGGTGCCC ATTGCCAGTG CCCGGGCACT TAGTCTCGCC CATAGCCGCA GTTGATGTTT CCCACAAATT TTCAGCCGCG TTTTCAGCTC TCAGTTTGCA GTTCACCATT TGGCCATTCG GGGATCTTTC GGTTGGTTTC GCCTGGGCGC TGGCGTAACG CAACAATTTC GCAATCACCT GACAATGTGA CAGGTAATAG TCGTGTCCAG CATGCTAGAC ATTTGCATAC TCATAGGCAC GGGCAAGAAC TGTGAAGTAA TTTCGATGCC AGGCGAGCAT CGCTCGATGG TCACCTCATG TCTGGCTATG GAGCATACTG TGATAAGTAA TTGCATTGCG TTTTCTGCAG AGAGAAAAAT AATGTTTGCA TATAAAAAAA AATACTTCTG ATAGAGCTTG TTGAATTAAA ATACAATGTT TTATGATGCT TCTTTTTATG TATTTTTAAA TCAAATCAAA AAGTTACTTC GAATTTTTTT TGCTCTGCAG TTGAGAATTT GTTTCGCATA ATTTGGGCCA TTGCCAGCTA AAGCCGAGGA AACCCAGAAA ACCTAGAAAA GCCGAAGAAA CCAAGGCGAA CCGAGGAGAA TCCATTCATG AAACGGGCAC CCGCCTTGAA GTTGCAGTTG AAACCGAACC GAACCGACTC ACAGCCATAT AAATTGCTGA GATTTCTCTC CGCTTTGACT GGCTGCCTTC CTGCCGTGTT ATTAAAAGTT CAACCCACAT GAGAAGCAAT TTGCAAACTG TTAGGAGAAA TAAATAGTTT AGCAGGGAGG AGCATGAGCA AGGATCTTAA GTGGCACTTG GCAGGAATTT GATAAGGCCC AGAGAGTTGG CCAAGATGCA ATTGCACCTG AATTGGCTGA GCAGCAGGTC AGCAGTTTGG CAACACAACA CCGAAAGTGC AGATTGGCCT CGGCTCGGAA AAACACTTTG CCCTGCCATT GGCTTCCATT TCAGTCTTCA GTTTTCGGTT TCCTTTATTT TTGGCTTCTT TTTGCTGCTT TTCACATTTA CGTCGGTGCC AGAAAAAAAG ACTCCTTTCG ACCAGATTTT TCCTTTACGT TTTCCACCGA TGCCAAGCCT TCTTTGACTT GCTGCTCTTC TGCCTTTGAC TCTTGCCTTG TTTGCTCTTC TGCTGATTAT TTCACAGATT AAGTTTATGG TTCATAAACC AGAAATTTCA ATTCAAATGC ACGAGGGGCA AGGAGGCGGC GCTGGGGAAA ACGAAAGATT TTTAAATAAA TTACAAGCGC ATTTTGTTGC CCCACGTTGT AGGCTAATTG TATGCAGAGG CAGCAGCGAA AAAGTATCTG AGAAATAGGA AAAAACCCAC CTGTGGGATG TGAGTGTGAT TTGGGTTGGG TTCC