Vienna Tile Information
VT ID VT058723
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201622
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 258723
Nearest Genes
Gene Nr FlyBase ID Distance
CG2302 FBgn0015519 24815 bp
CG1387 FBgn0030033 29079 bp
Sequence Length 2212
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GTCACCTGAACGACGGTGCACGAA
Right Primer GCCCACTTTAGAATCCGCACTCAACC
Template genomic
Sequence GTCACCTGAA CGACGGTGCA CGAAGGCAAG ACACAATGCC AAAGTAAATA AAAATCCAAA CTAAATTGAT TTTTTTTTTT AGAATACACT TAAAGAACTT ATGCACCTTG AAACACAAAT TATGTGTTAA AAGAATTTAA TAATTAAATA TATACATACA TATTCGATTG AATAGTGGAT CGTGTTTGTA TAAAACTAGC TTTTTAATAT CTGTACGTTT ATTATTTCAA CACTAAGCGT ATATTCCTTG CGCTTGATTT TTGTTATTTT TTTTCTGGGG AATTTTCATC GAAAACACAG CGTATTTTGG TGCAACGTGC CACGCCCAGA TGATACCACA AGCGGCTATT GTTGTTGTCA TACTTTCCTT TTAATTTATC AGCATATGAA AATCTGCAAC TGCAACTGAA AGCGACGTTG CAGCAGCTGG AAAGCGACAA CCCCCTCCCA CCCCCCTCGA ATTGCAGATT TTCCATGCAA ATTTAGGTTT GTTTGGCTCG GTCAGTAGTG GCATACAGCA TTTTCCAAGG ATGGCCACCA CAAAACTTGG CAATTTGATC TGGATAAATG GCGCTCAGTC AAAGGGAAGA GTTTCGCTTT CCTTCCCTTT CTATCCATTC TTTTGGTTTT TTTTTTTTTT TTGTCTTAAA CCATTTTTCA TTTTCGGTGC GCGCTGACAG TTTCCCTGGA GAAAACGAAA GTGAAAGTGA AAGTAGGTGG GGTTGCTTCA AAATTCAACA AGAGAAATGC GTGAGCGGCA AATGAGTCGC ACCTGGGAAA TGGGGGAAAG CGGTGAAAGT CAGTGTGAAT AAATGCATGA AATGAATGAG TAAATAGCTC GAATGACTAA CTGCGGCATT TTCCACCCAA GACATTTTCC ACCCACCATT GTTCGGGGCA TTTGCTCGAT TTACTAAATT ACTAGGACCA GGATGCCAGG ATGGTGTCGA CAACCAGTCG GCAAGATAGA GATAAATCCA GATGTACATG GAGTAATTGG GGCTCTGGAC GAGTTGGTTA TCCTGCGAAA AAGGGTCCAA GTCGGAAAAT GGCCAAATAA TTTATGGCTA AATGTAATAG CACTTTTATA GTTGTGTGGC CAATTGATTG AAACTTTAGT GAATTGGTAT TTTGTCTATG CACACTTGGA GAAATAAAGC TGTGCTTTCA CAAAAGGATA TGCAATAATT GGAATTAGAA TGAATTGAAT AATATTTTAA GGCATTTGGA ATAGTCAGAA AACCAATGTT TGCTGCCCAA TTAAATGGGA CGCGAATTAA ATACGAATAA ATATGAAAAC TTTACCGAAA TCTCTTCCAA GTCAAATCGT AATTTAAATG CCTGCAACAT TTCTGGCCCC ATAAAATGAG CGTTTGAATC AACCAACCGT GTGCTGCCCA ACTTTTCCCC CACAACAAAA CCCCCATCGA ATATCATCTT AATAAATCAG AGATTCTTCC ACACTAACCA GTATAATCTG GCAATTCAGC TGATCCCAGA ATAAAACTAA TATCCCTGGC TTTTTCCAAC ACAACATTTG GCTGGGCGAA AAAACCACCC CGCCCCCTCC AAGCAAATGG TGCGTTCAAA AACAAAAAAA AAAAAAAGGA ATGCGAATAG GGAAAGGAAA AAGGTGTGAA AATTCTGGGA ACACACAGCA ATCGGAGAGA AGGACGTGCG TGCAAGTGAG ATAGTGGATG GAATGTCCTT TGGCATTCGA AAATGGCATT ATCAAAATTT ACATACACGC ATATCCTGAT TATCCCTTAA GCATGAATTA TTGAAAGCGT AAATACCAAA ACACGGCCGA CAGTCGACAG CCGAGAGAAG GAATATAAAC AACAACAACA ACAACAACAA CAGCAACAAA GGCAGTAACA ACAACAACAA TGAGAGATTC GGGACAACAA TGCGACAGAA GTTCCTCGTG AGTGGCTTTT TAGGGATGCT GATAATGATA ATGATAATGA TTATGATGCT GATGATGACG ATGTGTAGAG CAAGTTACAT CCAAGGATGG GGCAAACTCA GCCAGACGAC GGCTTAATTT TCACATGACA AACAAAAAAA GACAAGCTGA GTGGAGACAT TTTGAATGGC AACTCAAGCT AAATAAGACA ACAAATTTCA CACACACACA AAAAAAAAAC AATAAAAATA TGAAAAAAAA AGCTGAAACA GAAACAGGTT GAGTGCGGAT TCTAAAGTGG GC