Vienna Tile Information
VT ID VT028321
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201576
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 228321
Nearest Genes
Gene Nr FlyBase ID Distance
CG8104 FBgn0036059 12450 bp
CG34356 FBgn0085385 29215 bp
Sequence Length 2256
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer CTGCTTTCCTGTTGCTTCGCTTTCA
Right Primer acCTCCTTAACTCCATTTGCTACTTTCCAG
Template genomic
Sequence CTGCTTTCCT GTTGCTTCGC TTTCAGGACC TTCGTTTTTG GGTCGTTTTC GTTTAACGTC CGTATACCTG CAGCTGTTTA TCATAATTTT GTTGATTTGC TGTCTGCTAA CAGTAACAAT AATAATCATA ACAGCAACAG AAACAACGGC CATGGCGGCA AAATCAAAAT AAAATAAAAG GGCGCAAAAA AGTTATACTT ACCATGGCGC GCCCAAAAAA CAAAAAAAGG GAAAAGCAGA CGGAAAAACC CTAAAACTTT GCCAAGTAAA TTTGAGTGTC GAAAACTTGT TTCAGTCACC AGGTTCAGCA AAAAAAAAGT TGGAAAAGTT CTGGCTGCTG TGTTCTAAAA AAGCGAAATC ATTATGATCG AAATTTGTTT ATTTATAAAA AATGGCAATT GGTATAAGCA AAAACAGGCT CTTCTCTTAA ATATACAAAC GTTTTTTAAA CAGAGGATTA ATTACACAAA AGCAAATCAT TAAATATTTA AAACAGAAAA CCAATGAATT CATATGCTCG TTGCAGAAAT ACATCAAGCT CATTGTTTTA AAAAAGTAAA TATTAAATCA TTTTTGTGCA TAAATATTTG ATTTTCAATT AATATAAATG GTTTTTTAAT GGCACAGAGG TTAATTCCCA AAAAATTTAA AATGCAATGT GTCAAAATTG CTAGATAAGA GGCGTGTTAA TCAAATAATA CCTTTCATAA CAAGAGTATG TAATATATGT AAGCAGATAT TAACGTAAAT AAGTAAAAAG CCAGGCGAAA AACTTTGTTT TTGTTTGGCG ACCAACGTGG CGTATGCGTC ATGTCAAATG GGTCGCAATG CTTTTCATAA CTTTTTTTTT TTGGCAATGG CCCTTTGTTG TCCTTGGCGC CATTTTATAA TGAATTGTTG TCACAATATA ATGTGGCCAT TGTCGTTGCT ATAGGCACTT GTGTGTGTGT AGGAGTGTGT TTGTGTCCGT GGCAATTTAA TAAAATATTC AATTGCCTTT TGGATGGTGT AGCATCGGTA CCCCAGGGAC GCAAATGACC AGACTTGGGC TGCCAATTAA AAACATGGCG TCATGGCAAC ATCAACTGCT AACGGCCAGC ACGCAAATGT TTATTAGCCG CAAAACGTTG CTCATTAAAA AAGTTCGTCA CGGCGCCAAG GCCTCGGGTT TTAACCTGGC TAACAGACAG CACTGTCCGC TGGATCTCAT TGCCTGATTA AAACTTTACC CAAAGCTTAC ACTCGAAAAA AATGAATGAG ATTGATATGA TTCATATGAA TTTATCTAGA TTTATTTTGC GTAGCAAAAG AATATAATTA ATATTCGAAA TATATATAAA AAAATAAGTA TTATTTATTC AAAAGTACTA TACCAAATAT TCGAAGAGTT TCTTAGTTAT CTGATTCTTT TGCGTGCATC ACCCCACGTT ACTTCTTTTC GTAGAATCAT CAAGTTGGCT TTAAAGTTTC GCTAGTAGCA GGCTCGTCTG GGTCTTGGCT TAAACCAAGT TGGCCGACAG GCTATGGCCT AATTACGGCT GCCCGTCATC ATGGGCATTA TCGTTATCAT CGTTTACATC GTTATGGATG TCGCCTGATT TTGTGTGCTT TTTTTTTTTG TTTTGTGTCC TGCTTTTGGT GGACAGATGT TTCGGACTCG ACCCGCCGGC ATTCGCTTTG ATCTACTCGT CCTGATTATA CGGCTACGAC TCAAGTCCTT TTTTATTTCT TTTTCGGTGT GTGCGTCTGC GGATTGTATC CTTTAACACA GGCCAATGCC TTTTATGACT TCATTCATCT TCCTGCCGCT GAGTGGGGAA TGTGGTTGTG TGTCTGCAGG AGTTCGCCTC TGCCATGACA TAGTATCCCT GTCGTATCAT AACCAATGAC CATGTGCAAC GCGGACTAAA TTGACCGAGT ATCTATCTGC AGGTCGCCGA CGCTCTTCAC TTGACACTGC ACCCTAATCA AAGGAAATGT GGGAAAAGCG GAATTGGGGC TGGGGAAAAT GGAGTCGAGT GCGTGGGTGT GTGAAACTAC AATCCAGTCA TGTCCGACAC TTCTCGTCTC GGTGCGGAAA TGTCGAGTGG TCTAGATTAC CCTAATCCCG CAGCATGTGG GTATCCAAGT CCAGGTTGTG GATTATATGT AAAGTATTTC AAGAACCTAT ATTATCTTTG AGTACAGAAA AAAGTTAGCT GTGTGTTTTG TAAAAACAAT TATTTACTGG AAAGTAGCAA ATGGAGTTAA GGAGGT