Vienna Tile Information
VT ID VT019906
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201574
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 219906
Nearest Genes
Gene Nr FlyBase ID Distance
CG13439 FBgn0040726 14362 bp
Sequence Length 2143
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GTCGCTCCTCCTGTCGTGTCCTGTT
Right Primer TGCGCGATGTCTGATTTATGTATGCT
Template genomic
Sequence GTCGCTCCTC CTGTCGTGTC CTGTTTGCCA GAATGTAAAC AAAAACTCGG CATCAGAAAC AAAGTGGACA CCGACAGCAG CTTATAAATT AGTGACTGAC TCAATTAATG AATGGGCCAA ATTAATGGAA CTTCTGCTCC GCTGGGGCGG TCCAAAATCC TGAAACGGCA AAAAGAAAAA AAAAAAAAAA CGAAATAAAG TATAGTGAAA CAGAAACGGC ACAGACGGAA AGTAAGACTC GCTTAAAGCC GTTCCAGTTT TTCAAATTAA AACGCTTCCG AGAAGCATTT AATTGACTTT GAAGCGTCCA CTATTTCCAC GCAGGTCCAA TGAAAATTCA TGAAAATTTA AATCGCTTCT CGCTTAGCCT TCCGGCCGAA GTCTATTGCA AGTCCTTGCA CAGAGAAAAA AAAAAAAACT TAATCATTTA AATTGCATCA AGAGCCAGCC AGCCGGGCAA TCCAAATGTA TTTAGCCACA GAAAGTATGC CACAGCGAAT TCCGTCCGTT GGCCATAAAA AACACAGTGC AATTCAAATA GCCGCAAGGA TGAAGGAGCC AAAACCAAGG AAACCGAGTC AGAAAGATAA GTAAATCATG CAACCAGAGG CAACTAAAGA GAGAAAACAA GGATAAAGGC AAAAAATGTA TATAAATAAG TTTTCTATTA ATCATAGAAA TAGCCGGCAA CAATGTGCCT GCTAATGGCG TAAATTTTAT GGCTGCCCTC TTAAAAGTGT GCAACATTTG CGGAAGAAGG GTAGCTAAAA AGGACTCGCA AAAGGTGTTT TAACTGCAAT GCGCTGCTGG CTAAAAGTGT TATTACATTT TCTGCTCAAA AAGCCAAGTA ATTAGTTTGG ATATTCAACC CCAGGGCAGT GACTCGAGTT TCCAGGACGC ACTTGCACGT TATCCTTTCG AAGGAGCACT GTCCGTAGTA TCCTTTTAGT GCTCCGGCCC GGCTAATGAA TAAGAATGTG TCTGGCCCTG TGAAGGCGAT AAACGTTTGC TGTGATTATT TGATTGGAAA GACATAAAAA CCCGGGACCA GGATACGCCA GGATACGTCT GCATGTGAAC ACATCCATTA CACACACACA CACTCACCCA CACTCGCATC CTTCGACAGG CATTTAATGG TCACTTTTAT GGATACGCAC TGCATCGCAT ACTGCCTGCC ATTGATCGCC CTTTTTCGTC AGTCATTAAA ATGTTTATGC CCCTGTCCGT CGTGGGCTAA TTGAAGAACT CTCGAGTTGG CCTTCAATTC GGTTCGCTGG CCTTAATTAG GTTGTAAAAC TTTAATTACG ACTCGTCGCA ATCAGCGCAA ATCATTTGGA ATTTATACCT ATGGCCCAGC TCCCAAATCT AATTTGAATG GCCATGGACT AAGTGACAAT CATCAGTCCC TGTCGGCGCA TTAATGAAAT ATTCAATTCG ATGGCCAGTT TCTACGGGGC TTTGAATGAT GAGCAGTGCT TAAAGTTGCC AAAATCGTTG CTCTTAAAGC CCGGTGCTCC ATCAGGGCGT AAAATCGATT TCGTGATATA TTAGACACAA ACACATCAAC GTTGTAGACA CTGGATCATG TGCGAAGGGA GCTTCGATAG CCGTAGTCAG ACGGAAAAAG CCGTGGGCAC AAATTGGATG TGTGGCCAAT GCTCGACGAA ACTCATCAAA ATGCAAAACA AAATACGCAA AAGTAATTCC CATCTACATT TAGTTATTTA TTTTCTCATA TTGCCACAAG ATGTTCCATC CGAGCATCAT TTACTTTAAT TGAGCTGGAT GAAGAGGAAT AAGTTTGATG GACCAAGTTT ACTGGTCCCA TATCGCGGGT ATTAGTTAAT TTTTTTTTGT GGGCTTTTGA TTGCTTGGGC AATTGCGAAT TTAAATGATG TGGCGGAATT TTCAAAATTT CCAACGCACT TTCATGGCTT TCGTGTGGCT GCTGGCAATT GAGTGCTTGA CAACGGGGCC AGAAGTGTAG TGACAGCAGT CAACGTGGCA CTGCCCACCG CAAAACGTTT TCGGATTACA TATAATTAAG CAAACTATTC AAATATGACG CATACGCCAT GTGGTTATGC ATCAATTAGC GCCGCCGACT GCAGTTAAGC ATACATAAAT CAGACATCGC GCA