Vienna Tile Information
VT ID VT025720
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201529
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 225720
Nearest Genes
Gene Nr FlyBase ID Distance
CG7509 FBgn0035575 2064 bp
CG32239 FBgn0035574 108234 bp
Sequence Length 2195
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CAAACACAAATTCACCACGAACGAAA
Right Primer GCCGATATAACCAGCGTGTCCATCAA
Template genomic
Sequence CAAACACAAA TTCACCACGA ACGAAATTTC ACATAGGCGA TTCAGAAACC TTTTACTTTA CTTAATATTA ATGCAAGTTT ACATAGAGCT TTCTAACAGC TACGTAATTG TTTTATTTGT TTTTTGAGCA ATATAAGCAA TATTCTACAT TAACTTTTAT TTCCTAACGA CATATTTACC AATGAAATAG CTTCTTTTTG AAGCTTCAGC ATCCTTTTAC TTGTTTTGTT TGAATTCAGA AATAATTTGA TCATTAGTGA GGGTGAGAAA GGAACTGCAT TATCCAAATT GAATTTTAAG TTTTAGTTTT TCCAACTTTT CCAAATTGAC CTTCTGTTAT CCGACGAAAA CACTTAGGCG ACAATTGGTC ATTGACTAGG CAAAAGGATC TCGGGTCCTT TGGAATCCTT TAAAACGCCT CCATAGGCTT GATACGACAT TCCGGCAAGA CAAGACGCTA AGATGTTTGC TTAGCTGGCA GGAGACTTTA AACTTGAGGG AATTTGCATA CATTAAGGGT GTTTTGTTAT TTTGTTAGCA AAAGGCAATT CAAATCCTTT TACTTCCGCT TTAGGCAGCA ACGACTACGG CAAAAGACAG ATGCGACTGA TAGCAGGATT CACATTCGCA CCACCGCCCC CTTCGGTTTT CCTGAACCCC CGCTCCATTA GTTTTCCCAT CCGTATTTAA CGGTGACGCG TGCGTTGCGT ATAAAGAAAA ATATGATTAC ATATTGTTGT ATTTTGAAAA GCCGGCGTAA AGGAGTGGAA AAGGGTTGAC ATTTTTTTTT CGAGGCTATG TCAAAAAGCG GAGCCAGCCA CTCAGAGGCA ATCAGCTTCG ATTGCCCCGA AAGCACAGGA AATAATTTCA TATGCCCCTA AGCTATATAG AAAGTAAGCT ATGTAGAAAT TGTAATTGCA TAATTGCAAA AGACGAACGA ATAATATTTT TCACGCTCAA AATTTTTCAC ATTTAATACA AGGAATTTTC CTCAGTGCAG ACAACTGCCA AACAAATAGC CAACAACAAG AGCCGAAGCG ACAACAAGGC CAACAATGGC GGCATTCAAT TTTTAATATT TGCCTTGCAA ATTTTGTATA AAATGCATTT GTTGTCTACA AGCCTCCAGG CCGCCATCCC CTGGAATTAC CAGGCCCCCG CCCCTTAAAA TTGGTGGGCG GAAGAAGACC GGAGACCGAT GACTGGCGGA GGGCACACTA TCGCCCAATA ACACCCGGAA CGGGGAAGCT CCAAAAGCTG GAAAACTGGC AACTGGCAAC AGGAAGCAGC CAGCGCCGGG CCAAAGTGGG AAAGTGAATG GAGCACGGCA ATGTCAACAC ATGGAAATTG CAAGGACAGC GGCAAAAAAA AAGAGGGAAA ACAGGGAAAA CCGAAAAGGA AAACGAATAG CAGCAGCCAC AGTAACTATA AACTGGAATG ATATTGCCAA CGAACATACT AGAACGGCAC TGAAAACAAT TTACTCCTTT GAAATAAACC CATATAATTC CAAACTATCT TCGTATCTGG TGCAAAAGTA TCTAAAACTC CATCGGGTTA AAGTACGCGA GATGCAGTGA AAGCTTTCTT GTTAATAAAA TGTTGTTTTC AGTGCAGGCA AATGGCAAAA GCGCAGCTAG TGAACCCAGT AGGACCCAAG ATAGCTCCTA GAACGAAGTT AGGCTGGGCC GGGCGGAAGC AATAAATTGG TTAGGTAAAA AGCTTGTCGC AAACGCAGAC ACCGGTAAAA AGCGGCACGC GAGGCCGAGA CAGGCCCGTA ATTTTTGCCC ACCAAAAAGG CAGAGGAGGA GGAGGAGACG GAGTGAAATA GAGGTGCCCA AGGATGGTTT ATTTCCCATG AGGTTGCAAA TTAATACTAA ATGTCTGCCA TGCAAACACA TAATTGACTT TAAATTTGTT TTGACAAGAA GAAGTGGAAA ACTTTGCAAC TTTGATGGGG GTGGGAGAAA CTGCAAGTTT TGTTTCCGAC TTAGAACCAC CAAAAGGTTT ATAATTGTTT TAAAATAGCC CAGAATTCCA GAACGTAAAA ACATAATTTT AAATATTCTA AAATAATTTA TTTCTATTTT CTGCTTATAC GGATATAAGG TGTATAATTC TAATCCTATG TCTTCAAATT GTCCATAAAA GAACTAGTTA TGAACCTTCT TGATGGACAC GCTGGTTATA TCGGC