Vienna Tile Information
VT ID VT038111
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201507
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 238111
Nearest Genes
Gene Nr FlyBase ID Distance
CG17816 FBgn0037525 25296 bp
Sequence Length 2311
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCACTTCGTAGGCAGAAATTAAAGTCACG
Right Primer GGTGCTGGTAGCGGTAGTCAAGCAAA
Template genomic
Sequence GCACTTCGTA GGCAGAAATT AAAGTCACGC TCAAATTAGT ATCTTACTCC AATCTGTACT CCAATCTTCT GCTCTACATA GTGGTCAACA ACCTTGTGTC TACTCTACCA TCTTTGACAT TCTGCGTCAC CGTGAAGGTT TTGCCAGTGT CCAGGGGCAC CGTCCAGTTG ACTGGATCAG GAGAGCGCAT TATGATCTGC TCCGGGGATT TGACCCGGGT CGGTTCTGGT GGCGACTTCA CCAGGGGCTC CTCGGGCACC TCCGGCACCG GAGGCTGGGG ACTACAGCTG GAAATGGAAA TGGCAGTCTC ACGACCATCC TCGCCTTCGT CTGTTGGTTG GGAAAATATT CAAAAATACT TATAAATGGT AGTTCTGCTC AGTTTGGAAA GTTATGCGTT TTGGAATTAA CTTAATTATA AGCGCATTTT ATGTTTCTGT TATTTCATTA TGCTGCCGTA GCTGTTGATC TTCATAAATT TTTTTTTGGA TAAGTCCTTT GTTCGTTAAG CAAATTTTGT GTTTTTGAGT TTTACTGGTT AGTATTTGAA ACATAAAATC CAAATAAATA TTTCTAACTT AGTTCGGTAA CCGAAAACTG AAGGAAACTG AAGTCAACGG AAGAATATTA AGCCAGAAGC TTAAAAGGCA ACATATTGTT AGTAGAACCA AAGGAATATT TTTATTTTTT ATTTTTTGTT TTATTTAATA AAGCGCACAA CATGAGAAAC AGCATGCCAC AAATACACAA ACAGACACGC AACATGAAAA TCCGAAGAGG AGTAATAAAA CTAATATATG TTTTATGTTT CAAAAGATTG GTATAGCTGT ACAAATCCTG GTGTGGCACA TTGCTGGATA TGTTTTATTG GTGTTTCTTT TTTTTTGGCA GGCAACAACG AAGGCGTCGA CGACAGCTTA AAAAAGATTT GTCAGTTAGT CCCTGGCAAT TCGAGTTCGC TTAGATATTA TCGAACACTC ATCATGTATT TTAACAGTTG GTAATATTGA AATTAAAGTA GTAGATACAA AAGTACACGT TCCTACGTTG ATTTGAAAGT GAACTGTAGT TAGTAGAAAC GATTTACTTT CTTCTAAAAC TGTTTAACTA ACCCAAACCT CCATTTCGAA CATCAAAATA CTAACTAACA CTTCTACCTT ATTGTTGTTA GTGTCTGTGC TTAAGTGTCT TTTTGTAGAT TATGTTGTTT TAAAAGAAAT AATCATAGAC ATATAATCTA AAATGAGATA AGATAGAAAT GCTACAAACT TTACATATGT ACACAAACAA ACAAAGGTAT ATTTGAAATT CTGAGATGTG ATTTAACAAC GAAAATCTAC AAATCATGAG ACGCACATTC AAGGGCATTA AATTTAAATT GCTTATACAG ATACATTTAT ATAGACGCAC GGCTGATATA CAACGAATAC ATACACTGAC TACAACAACA ACTAACACTT AATAACATTT AATAAGGCAT TTTGCTCTTT GGGTGTAGCC ACAATAAACA GCAATTAAGA ATTTGGAATT TTGTTTGATT TTCGTACTTT TTCGGTGAAT TTTATATTCA TTTTTGAATC GGGCTGCCAG TGGAATAACT ATAATCAAAC TACAATTTTG TACACTTTCT ACGACCAATC TATCAATACA GATACACAAT TCCACCTGGC TTGGCCCAAA CAAAAACACA CACACAAGTC CATCTAATCG ATGTGGCCAA TCGGTAAATC ATAAGCTTAA TCACTTTTCA CTAATTGTGG ACGAACAGAT TTGACCAAGG TGTAAAATGC TTAATTATTG ATAGCGTGAA AAGAGATTGT CTTTTCGTTT TTTTTTTTTT TTTTTTTTTT TTTTGTTTTA AGTTTAGGGC TTTACAAAAG TTGCAACACA AACATTTCGC GCATCAGATG TCATTTTACA GCATTTTCCG TGTATTTTAC TTTTTAAATG GGCTTTAATT TTGGTTTAGC TTGGGTTTAT TGAAGAGTTT GGTTTTTGAT TGGTTCAAGT TTTCGGTGAA ACTTTACTCA CTTTCAGCCA ATTTTCTATC CTGACCTGGT ACCGTGAGCC GTTTGATGTT GATGGTGGCA GGCCGGGTTG GGTTTTGGGG AGGTGCCGAT GTTGCTGCTG CTGCTGTTGC TGCTGCTGCA ACATCGAGTT GCTGCTGCTG TTTTTGCTGC TGCTTTTGCT GTTGCTGTTG CGGTTGCTGT TGTTGTTGTT GCTTTTGTTG CTGTTGCTGC TGTAGTTGTT GTTGCTTTTG CTTATTCTGC AGATGCTTGA CACTATTTGC TTGACTACCG CTACCAGCAC C