Vienna Tile Information
VT ID VT045148
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201446
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 245148
Nearest Genes
Gene Nr FlyBase ID Distance
CG10823 FBgn0038880 11306 bp
Sequence Length 2203
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGAAGAAGAGCAGCCAAGGAATGGT
Right Primer GGCCACAATCAGAGGAGGAGTTTTG
Template genomic
Sequence CGAAGAAGAG CAGCCAAGGA ATGGTGGTCA CCAGCGCGAT TACCCATATG CCGATTATCA TGATGCGGGC ACGTCGCTTT GTCATCTGCT TCAGGGGCCA CCAGATGGCA ATGAACCTGC AAGAGGGGAG TCCCAACAAA GGGGATTTTT ACCAAGTAGT CAAAGAAGGA GTCTTCGTAG GAGCAGCAGC AGCAGCAGGA GCTCCGGCTT CAGATGCCAC TGACGGCTTT GAGCCGTCAA GGATAATGGC AATCATCAAG CTGTCGAGTC GAGTCGAGGC GACGATGACG ATGACGACAC CGTTTCAACT AGGAGGAGCA GCTCGGCATG CAAATATCTC CGCTGATTAA TTCGCACACG CAGGATGCCG ATGCCAGCAG CCATCCTTAA GCCTTTTTCT GCTGAGTGTT CGCTTTCCAA TCTCGACTAT TGAACCCGCC TGCTACTCCT GCTCCTGCTC CTCCGCCCCA AAAAAGCGGC GCTGCGGATC CTGTCATTTT TTATTCTGCT TGCCATAATG AATTGTAATT TGAATAAGAG CTGCGAGGTA GTGAGACGAG TCGGTATGGG GCCAACAACG AGTTCAGCAT TTTTCATTTA GCTTAGTGCA GCCGGCTCAT TGTGGCGCCC GCTCAGTGGT CATAGACAAG ACTTGTCCCG GACGAACGAA ACTGGTTGTC TGCTCCTGGC CCGAAACCAT GTAATTACGT GCATTGTGTT CGTATTTTCG ACTTGGACCT TGGGTTGTCG CCTGCGTCTG TCCGCCAAAA CATTTGGCAG ATAACACAGC GGTAATTCCA TTAGAGGGCG GCCATGCCAG GCCACTACCC CAGAATCCTA TTCCTCACCG ACTAAAAATA GCCAGCTTAA CAATGTGGCC GAGACCCTCA TCTCTGCGAA AAAAAAAAGG TGGGCCGCCT GGGCGACCAA ACAAAGCTGT CCGCAAAGCC AATAATCAAA TTGTCATAAC GTTTATTTAT AGGAGCAAAC CAATTGCATT TGCATAATTT GCCCATGCGA CTTCTATGGT CATAAATCAG GCGAGAGCTT AATTGAGTTC TTTTTGGGTA AAAACAGCGG AGTCGGAAAA AGTAATCAGC AGTTTTCGCT GGTGCAGACT AATTCAAACT AAACCTCTAA TTTGATGTTG AAATTTTGTT AAATCGTATT AACTACACTT TTGATGATGT AAACCATTTT ATGAGCTTTA AAAACTAAAA TTTCTCTTAT GAGTTCTCTT ATACGATTTA TGTATGATTT GTTTCACAAA TAAACTCTCC TTATAGATTC AATTGCTGTC GGAAAATTAA ATTATTAATA TTATTTTGGT AATCACGGGT AATTGTTGCC CATCAATTCC GTTGAGTACC ATATGCGTAA ATCTCTAAGG ACGTCAGTTC AGTATTGTTA GCATATTTAT TAAGAAAAAT CTTGCCACAA TCAACTTAAA CAAAGTAGTT AATACTCGCG CTTTTAAAGC ATTTAATAAG CCGCAAGTGT ATTAATTTAA TATTTGCCAC ACAATCCTGT GTTTCTGTCT AGATCCACGT GGTTTTATGG CTCCTATTTC GCTTCCTACT GCGGTTACCC ATACGCACTG TTGACATTTG CGACGCAAAG AAGACACAAA AGCCGCAATG CCAGCACCGT AAAGACACAA CTATGTCTAT AAGCGAGTGT GCTTTCTTAT AGACTTTATG ATTATAAGCA ATCTAGTTAT ATACATATAC GTATTCAGAC AAGAAAAGAC CCTAATTAAA TGACAGTGGC ATAAGTATAA ATATAAGTAG AAGTAGAAGT ATAAGCAAGT GATAAGCTAA GTCGAAGGGG CATTACGGGC TCTAAGACCG TGGAGAGATT TAAGTTTCAT GTTACAGATA ATAAATCTTA AATTTCGATT CAGTTTACGA TGGCTCGTAA AAGGAGAGAA TAACAGCAAA ACAACTGGAT AAACGGACAT CAATGACGCT GGACTCGGAC TTCGACTGGG ACTTGGAAGT GGAAGTGGAA TTGGAAGTGG ATGAGGATGT GGATGTGGAT TTGGACTCGG TTGGGTTGGC GTTAAGCGTG GGCGGAGGCT GACATGCGGG CCTGTGGGTG ACCAAACGAT CAAGTGAGGC GCTATGCCTT TGTCCCGCTG GCTGAAAAAT GACAGTGGCA AAAACAGAAG CTTCTGGCCA AAACTCCTCC TCTGATTGTG GCC