Vienna Tile Information
VT ID VT019018
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201431
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 219018
Nearest Genes
Gene Nr FlyBase ID Distance
CG15105 FBgn0034412 19082 bp
Sequence Length 2252
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGCCGACTCCAGCAACCACC
Right Primer GAGCCCCAGGAACCGAAGGTCT
Template genomic
Sequence CGCCGACTCC AGCAACCACC GCGTTCAGGT CTTCGACTCC AATGGCATCT TCGTCAAGGA GTTCGGCGAG TACGGCAACG GTGAGGGCGA GTTCGACTGC CTTGCCGGAG TGGCCGTCAA CCGCATCGGC CAGTACATCA TAGCCGATAG GTAAGTTAAG GGGTACCACA TTACGTAGTT AAGATTAATG GGCGGAAAAC TTCTAAAGTT TAACATTTTA TATAGATCTC ATTCATAAAA TAGCTTTAGC TAAGTCCTGG CTATGTAAAA GTAAAAAATT GATATTGGCT TGTCTACTTT GGCGGTGATA CTTAATCTCC GAGTGGGTGA GCATCTGCTG GTGGTCAGTC TGTGTTTTAA TTAAGCCGAA ACAAAGGCGA ATGATTAATT CCCCGGCTTC CCTAGCTCCT CCTCTAATTG GCAGGGCTAA GCGCATAATA GCCGCGTTAA TGAGAAACAT GTGCCGGTTC AGTTGGGCGT AGTGCGAGAT TTTGGCGCTC CTGCACATGT TATCTGCAAC CTTTTTACGA GTGCTCCTGG TATCCGCGCG TTTCCAGCCC CCACATCCCA GATCCGATCT CCCAGCCTCC GGCGGCCACT GTCATTGTTT GACGCAAAAT CTCGTTAAGC ACCCAAAGAC CCGGGGTATC CTCATTGTGC GAGTCAACTT TGATTTTGCA CGTTAAGCGG CTTAGACCTA AGCCCAACAC CCATCAGCCC ACGCCGAACA GCATCACCAC ACCACCACCG TAACCCACGG CTGAAAACCA AAAATCCACG TCCAACACCT TGGAATTCCA AGGCGTCGCA TTTTGGCTGA CGACCCGCGA ATCTTTTTTG GGGACCGGTA ATGAGATCTC TCTTTTGGCA CAGGGTTCAC AATTAACGGG GGGAATTCTC CGATTTGATG GCCTAATAAA TTGGCCAGTT AGGTTGAACA TGAAAGAAAA AGAAGGTACA CGCATTGGTG GAATTTGGAG AGTGAACCAA TAAAGTCAAA TAAAACATAC GATTTTTGCT TGTTATAATA TTTGTCAGAT GAGATTTAAA ATTTAAATTT ACTTAATGGT TTCAAAACTT GTTAACCTGT GTTATAACTT TAATGAGGCA CTATATATTT CAATAAGATA AGTAAGTTTC CTCTGTTCTT ACTTTTCGCT TGCAGATACA ATCATCGCAT ACAAGTGCTC GATCCGCAAG GACGATTCCT GCGCGCCTTC GGTTCGCAGG GCACCGCAGA TGGCAAATTC AATTATCCTT GGGGCGTAAC AACCGATGCA CTCGGCTTCA TTTACGTGTG CGATAAGGAG AACCACAGAG TGCAGGTGAG GAGGAAACGG AGGATGCACC CATTTGGTCC GGGCCCCCAT CCTTTTCGCA GCCTTTTTCA GCTCGCCTCG CCATCTTCAG TCTCGATTTG CATGCAAATA TTTATATATG CAGTGGGGCA TGCGGAAAGT TTTGGGCGGC GGAGAGGCTC GAGCCTTGCC CAATTTGTCA CACTCGAGCT GCAGCATCCA GCAGCAATTT TCATGGGCTT AACTAGCATA TATACATATA CATATATAAG AGTGTATATT TCAGTTTTTG TGTGTACTTT GACTGCATGG TCCATCCTTT CGAGTGCTCC TGCCGATTTC AATTTGCAAA CTTATAACGA ATATTCGCAT TCGTCAGGTT TTCCAATCCG ATGGTTCCTT CGTTGGCAAA TTCGGTTCCT GCGGCCGTGG CGAGGGACAA CTTGAGCATC CGCATTATAT AGCCGTATCG AACACGAATC GTGTGATTGT TTCCGATTCG AATAACCACA GGATTCAGGT GAGCCAATAG CCCCCGGTTG CCACTGGTCC CTTGGGCTTT TCCATGCCTG TCTGGCCATG TGAACAATTT TAATTAAAAT ATGCTCACCA TCGAGATTCA TTCCCAATTT ATTTGAACTT CCTGCACCTT CCGTGCCTGT CACCTCTTTC CGTATCCGTA TCCGCAGATT TTCGACGTAA ACGGCAAGGT CCTCTCCACG GTGGGCGGCG AGGGTTCCGA CGATGGCCAG TTCAAGTTTC CACGGTAAGC AAATCGAATC ACCCATTTTA ATTGACAAAG TATTGAGGTC ACACTTCTGT TTTTTATTTC CCGCACAGCG GTGTGGCCGT GGACGATCAG GGCTACATAT TCGTGGCCGA TTCTGGCAAT AACCGCATTC AGATCTTCAA TCCGGATGGC AGTTTCCTGA AGACCTTCGG TTCCTGGGGC TC