Vienna Tile Information
VT ID VT017262
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201406
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 217262
Nearest Genes
Gene Nr FlyBase ID Distance
CG8204 FBgn0034033 56651 bp
Sequence Length 2171
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGCCAGGGAGCCAAGGAAAAGAG
Right Primer CGCTACAAATGGGCGTATGAGTGAA
Template genomic
Sequence TGCCAGGGAG CCAAGGAAAA GAGCTTACTC TAATATTTTC TGTGTGTTCT TCTCTTTTAT TTCTTCCAGA TGTCTTTGGG CTCCTGCTTG GACTTGGAAG ATGGAAATCT TAATCCAAAC GAATGGAAAT GGAAGTCGAG GTAAGTGGCT GAGTTTCTTG CCGTATTAAG TTTCTGCTTA GCAAGCAAAA GTTCTTTCAC TACTACTCGT AGTGGGACGT TAACCCTCTG CACAAGGGGT CTGCGTTGAG TATACGCAAC GTGGACTGAC CCTATTAATT GAACGCTTGT TTATTTATGG GCCTCGTTAT TTGAGTGCAT TCAAGTGTTT TGTACTGCGA GTGGCCACGC CCCTTCTGTG GGGTGGCCGG GCAGGCGGTC GCTATAAATT GTTAAGTTTT ATCAGCCGCA ACAACAGGAG CAGCATGAAT AATAAGGCGG AGCACCGCCC ACTTTCGCAT TGCGTGCTCG AACAGGAACA GTCCTGAAAG CCTGAAATCC TGAAATTCTG AAATACATGC ACACTGCCAC TCGCATATGC AAAGCCACAC ACACACACAA ACATACACAT ACGCACTCGC ACGCACAATT GAAGCGGAAG TGCGCATTGT TTCCGCTTTT AATAAGAGTC GTTGTTCGCT GCGGCGCTGC AACAAGGTTC TGCATATGCT CGGGCATAAT AATAAAGCAT GCCGCCTGCC AATTCTCTGG ATTGGGAGTC GGTGGCCAGA GCGGGCCATA AATTGCATTA AATTGCATTT AAATGTGTCG GACAGGTTAA CAATGCGAGG AGTATCCGCC ATAATTGATT GTAAATTAAA CCTAACTCCG GCCAAGGCGC TTAAAGGCAG CAGCTTAACG GTCGAATCCT TATATTGCCC GTAATTATTC GGCCATTTTA ACACTCTCCG CTGTGTCCCC AGTTTAATTT CTACGCTTTT GAGCGTGAAA TAGCCGGAGC TGCAAGCGAA AAGAAAGCAA AGTTGGGCAA ACTAGCAATT TGCTATGCTC TACAAGGCAC TTTTGTCCTC CTCGGGGAGG CGAGAAAACT TTAATCTTAT CCCAAGGAAA TTTGCATGCC GCTGGGTTCT TTTTTTCGAC GTGCTCGTCC TTCCTCCTTT TGGTTATGGC ATGCCTGTCG ACAATTAAAC ATATTCACCA TTCACATTAA TTGTGGCGAA ACTTTCGGCC AGAAACCACC AACCTGCTGT GCCACCTGCG GTGGCTGCCA CAAGCACACA CTCAGGACAT TCTCGTTTGT AGTGCCGACG TTTGTAGTGG CGTATACTCA ATTTCTTTTT CCTGTTTTTT TTTTTGGTCC TCGCCTGGAA CTGACTATGA TCTATGGCAC TTGGCATGTG TGAAAGTGGG CTGGAGCGGG CGTAAGTAAG GGGTGGGCAC TTAAAGAAAA TTAGGGCTGT GATCAGAAGG AATATGTATA ATAAACATGA ATGAGAACTT ATGTTTGCAG AAAACTAGAA AAGTCTTCAT TCAAAACAGC ATAAAACTGC TTTTACGGTT GCCAATATAA TTGCCGACAT AAACTCTGCC ATACGTCTTA GAATACCAAA GTTCTAACAT TTCTAGTAAG GACTAACCTC ATTTTCCTGA TTGCTTTCAT CACAGATTTT TCTCGAGTGC AGCTCCCCAA GGTAGATGAC TTTTCTTCTC CACTTGATTA GCATTCGCCT TAGCCATTTG AGTCGCTTTG TGCTGGAGTG CAGGAGCGTG CCTATTGATG CGTGCTAATT GCGAAGCGAC TCCGCATTGA AGTCCGTGCC AAGAATATCC TGGTGTGCCA GGATGCCACA TTGTTATTTG GACGTAGCTG GTGTGCATAA CAAGGAAATC CGTTTCGAGT GCGAGTGGAG ACTGCAGTTC GTCTTTGTCT TGACGGAAGT TCTCGAGAGC TCCGACTGGC TTCGAGTGTG CTCTCTTCGA GTGTCCTGTC TGGCCGACTG GCTCCTCCCA TTTTTCATTT TCCATTTCCC CTTGCTACCG GCTGACCCAC TGCAACCGGC TTATCGGCCA GAGTCCTTTG GCAAAGCAAC GACCAGGTTT AAACCACTGA CAGCACTTAT CAAAACGTTC AATCAATCAA TCAATTGTTG CCAACAAAAG GGCGCTCAGG GAAAAACACA GTAATATTCA CTCATACGCC CATTTGTAGC G