Vienna Tile Information
VT ID VT049126
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201374
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 249126
Nearest Genes
Gene Nr FlyBase ID Distance
CG14521 FBgn0039617 3582 bp
Sequence Length 2106
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AAGGCGGACACCATTCACAAAGCAA
Right Primer CCACCGCAATAGCTCCTTCAGTCCTC
Template genomic
Sequence AAGGCGGACA CCATTCACAA AGCAATTAAC GCAACAGCTC CCCTGCTCCT TGCCCGATCC CCCCCCCCCA TGCTCCTCCT ACTCCTTTTA GGCCGAAAAG GAAAGGCAGG AACCCAATTT AACTGACTGC CAACTTTCCA CAATCACTGC CCATCATCAA TTTCAGATTT TGTTGTATGT TTTATGAAGC AGTCAAGGCA CAGGACAGCC GCCCGTCAAC CAGACACTTG GACAGACAAA CAGACAGGCT CAGAGACAGT CTGGGATTGG GTGCGGCAGA GTGGAGTGGT TGAAGGTGGG CTCTGTGCTC TGGATTGTGG GTGGAGCTGG GTGGGCTGGC TGGGTGTCGC ACTGGTGTTC GGTGGAAAGT GAAAACAATG CCTGGCCGCA AACGGCTGAG CAATGGCTGT CCAGGGAGGC GACCGCCTGC CGAGTGTGTG CGGATGCTCC TTGCTGAGTG TTTACTTAAC CGTAAGCCTG ACCCACCGAC CCATCCATCG CAGCCAACCC ATGCCACCCA TGCCACCCAT GCCACCCATT CCGGTCAATG CCACCCACCG ACCCCCGGCG GTGAGCTGAA CTTGAACCAC ATTGAAACAA CAAAGGCGAG CAGATAAACC AGCGATGGGT AAAAAAGGGT TGGACGGGCA TCTTAAAGGA TTGCTCAAGT TGGCCAAAAA CCAATATGTA AATGTGCGTG TTGTGATTAA GCACAAAAGC AAAGTAAGCC AGATACAAAG ACGGCCAATT GGACGGCGGA CTGCGGACGG ACGGACGGAG TTTTCTTGTC CGATGCCAAA GTCCCGAAAG CCAAAATCTC CAACCGCACC GCACACACAT AATGTGGGCC AAAAACGAAG CCAAGCAAAA ACGCAGCCTT GGCTAACTTT ACACACCTCA AGTGTTTGTT TAGGTTGCTT TGCTTTGCCT TGCTTTGCTT GGGGTTTCGG TTTTTGTTTG AGCGATGGAC CTGGCCGAGG AGTCCTGGGG TCGGGGAAAA CACTTAGGAA AAATTACCAA AAAAAAAGAA GATTAGTGCA ACTCGTTCAA CTTGCGAGCA AAACCGATGC GCAGTGGTCA AAAGTAGTTT TGCAATCCAC AAAAACTTAT CTGAGCATTT GCAAAAGCCC ACAAGAGTCC ACAATCCATC TTAACTATGC ATTCGACACT TCAATTATTA TTAGGCATGT TGAACTAACA AAATTATAAA ATAGTTTGGA GTACGCTTTA GTACTATTGT ACTGAACTGA AGTGCATGTA AATGTACAAA GAGTGTAAAG AAGTAGTAGT TTGTTGTTGC ATCTTTCAAA GTGGTATTCA AAAACAGAGT ACAACATTCT TCCTGCAACC TACTTATGTG AACTGCAAAT ACACGAGAGT CTTGCATTAA GAAGATTATT TTATTGTAGT GTAGGGGCAG AATTTCCTGT GGCCATTTGA CGCTTTTGTT GTTTTTGGCC AGCGGTATTA TAAATCTTGC CCGCAATGTA GAAAGCGATC AGATCCTTGC TCCTTCTCCG CCTCCTTTTC GTGACCCCAC CATCCACAGC TCGTCGCATC CAAAAACAAT GGCTTGGAAC CCTATTAGCG TAGAGCCACC CCCCTTGGCA GAAGATTCTC CACAGGAGTG TGTGGAGTTT TCAGGGGTCC GGCCATAAAT TGCAACCGCC AGGTGAGCGG TAAGTGGGTG CGGTTTCAGG TGTTGCGAGG GGGCTAATGG GTCACTACTT GATGTATCAC ACAAACAGAC ACAAATGATA TTTATGCTGC CGCAGTTGCT CCTTCACCAG CTCCATCTTC AGCTTCTCCA GCTCCTTGGG CTTCGGCGGA GGAGCCCGTG AGGCTTCTCA CGGCCAGAAG CCGCGCTCTG CTTGGTGTAA TAAAAACTAA AATCCGCACA ACAATATGTG CGAGGATAAT GCCATTTCCG TTTTATGGGA TATCCTGTTA GTCCTCCCCC AACCCGCGTG CGAGAGAGTG TGTGTGTGTG AGCTTTCGCA TGTGCGAGGC TTCCTCAAGG AGCCCCAAAT CTGAGCGAAC GAGTTACGAC TACACCGGGC AAAAATGAAG AAGCCTGGAG GAGGACTGAA GGAGCTATTG CGGTGG