Vienna Tile Information
VT ID VT040053
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201352
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 240053
Nearest Genes
Gene Nr FlyBase ID Distance
CG33512 FBgn0053512 3389 bp
CG14708 FBgn0037910 9424 bp
Sequence Length 2132
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGCACACACACACAAGTTCGAAGGA
Right Primer TCGCGGTATGCTTATGCAATATCTTCAGT
Template genomic
Sequence CGCACACACA CACAAGTTCG AAGGATACGC GGAGAGAGGC ATTTTGTGTA TCCGTCTCAG AACGTGACCA ACGATGGGTC CGTGGGATTT AGTTATTAAA CGGCTTTTGG CTTCTGCCTT CACTTCATTC CTTCGTCTGT TTTCATTTTT AAATGTGGCA CAATGCTATG TGGCGATGGT GTTGCTGCTC CTGCTGCTTC TGCTAGCACT TTCCCTTTTC CCGGTGCTTC CCTTCCCGTA TGAGTGATTT ATCCGACGGC AACAACGGAG CAGCGTTCAC GGGCATCCTT GCATCAGGAT TCGCGTGCTG GAACTGATTT CGATTCCATC TCGGCGAGCG CAAGGAACTT GCACCGCGAC TCCGAATCGC GAGACTCCGA AAGGTGCTCT CCCACGCAGG CGCACGACAA AAAGGACCTC TGTGGATGCG AGAGGATTTC CCCGAAAGTC AGAGCATATC AAATATTAAT TCGCCATCCA TTTGATGTCG CTTTCTTTGC ATGCCTGATG AGCGGTTTTA TTTTAAGGCA AGGGTTTATT TTCTTTTCTT TATTTCGTCG CTTTCCGTTT TTCAACACGA CTCGGTCGTA CTTTGGTTTT CCAGCTAACC ACCAAGCCGG ATCGTTTTGC TCTCCATCCT TCCTCCGTCG CAGTCTCTCT TTCTCCCTCG CTCTCTCTCT CTCTCTCTCT CTTGGGCTTT CGCCATCTGT ACTATCTGGG TTATTAGCAC AACCTGCCTC AATGCGAGAC CGACTGGTAA CAGTCGTGCC GAATCGAAAT CCGAGTGGTG GAAATCGTGG CCAGACGAAC CTAATATGCT CCATAGTCAC GTACAAATGA ATATTCGTAG TAGAGACGCC TTCGTTTTGG CATATTAATA TAGTCTACAT TTCGGGGCAC AGGCAACCCG CACTTTTTTG TGTCTTTCTC GCACATGAAT GATTTACACC CGGGCCATGT AAATGTGATT TTTACCGCAA TATATAGGTA TTGGTTTAGC CATAGGTATA GCCATGGGAA TCCTTTTAGT TTATACGCCA TCGAACCGTA CCGCACCCAT CGCCCCCTCC ATTCGCGCAA AAACAATTGA ACAGACAGTT ATAGGCCAAT TTCAGTTTAT GTCCATGCGT CGCACTCGAG AGAGATTTGT GTGGCTTCGT TAAGGGACTA GAAAACGTGG TATAGGCTGT AGGCTAAAAG CGCTATAAGG GCTATAAGAG GGTTTAAGGG GCTTATGGGG TCTATGGGTG TTTGGGGGTA CGACCAACAC CTGTACCTCG TCGTCGTTGC TGCGCCGACC ATGTCAAATG TTGCGTGTTA TGGCCACAAA TGTGGCTGTC GAAAGCGTAG CCACCCCCCA ACCTCCCTCT CAACCATCCT TCCCCAGTAC ACCCGCAAGT ACACCCACTA CCCCCGCAAC CCATCCGTAT TCAGAAAACT CGGAACGGGC ATTTCAACGC ATGCCTTACG AGCTCATAAA TAAAATGCCC ACCCAGTCGA AGGCCGATAA AGTCGAGTGT GCTTGACTGG GGAATGCCCT GTAGGCCTCA AAACATCGCA ATGCAAATGA GCACGGCGCC GGCGAAAGAG ACAGACGCAC TCAAACGGAC AGAGATAGGT GGCTGGCGAG CGAATGAGAT AGCAATGTAG AGAAACAGCG AGCCAATGCA ACAGAAAATT GACAGACAAT GGCCCTGTAA TTGACACGCC ACCTAGCGGC CATTACGAAT GATTAAAGTT GTTTTGACCC TCCCAATTGT GCGTGTGTGT GTGTGTGTGA GTGTGTGTTG CCACGAGTTG ACATTTGATT ATAGAATTCC ATTACCAAAC AATTGAAATG GGAATACATC GAGTTGACCA GAACGGAGGC AGAGCCGCAC TAAGCAGTTT ACAATTTCTA TAATTAAGTT AGCACGCAAT CAGGTCAAAC GGAACACAGG AAGAAGCGAT CTGGATAATT ATAGAATTAT GATTTAATAT CAAATCTGAT AATAATCAGT TGGATTAGGC GAACTCTTTG AGATACTATT ACAAATTGAG TTTTTAAGGC GATTAAAAAA AGGCATCAAA TCTTTGAATT TTATGGCCAT GATCCTATAA CTTACTGAAG ATATTGCATA AGCATACCGC GA