Vienna Tile Information
VT ID VT039961
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201350
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 239961
Nearest Genes
Gene Nr FlyBase ID Distance
CG6715 FBgn0026064 8738 bp
CG17228 FBgn0004595 10476 bp
Sequence Length 2131
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GAATCAACTGTGGGGAATCGGGCT
Right Primer ATTCAGGATGGAGGATTTGGCTGGT
Template genomic
Sequence GAATCAACTG TGGGGAATCG GGCTGAAAGA ATCCTCCAGT TTGGGCGACA GTTCACCGAC ACGCTCAAAA GCCTCAAAAG GAGTGCGGGC ACGTCTTTCA ATCTGTGACT TTTGCGCCAG CACCAGCGCC ACCCTATGCA AATAGACAGC CCTCCACCTT GAGCAAAGTA GGATAAAAAG AAAATGCAGC AAAAACGCAG CTGCAGGGCC GAAAGGGGGT GAATGGAGGG AGGGGGGGGG GGGGGGGGGG GGTTGGTCCG TTGCCGCTGC AGACACATTT TAATGATGCA TGCAACAGTA AACTGCAATC AGATATGCGC ACATCGTTAG TCTTCAGCAT CAGCCGCCGT TTGTTGATTA TCTTAGAATG GAGAGCACGG CAAGAAAGAT AACTCATACG CCCCGTTGGC CGCACAACCT GTGCACTTTC CGCATTGCAT GGAAATTTAT TTGCCGAGCA AATAAACTGC AGTCTCCCGT TTGCAAGAAG TCGGTACCCG GATTCTTGGC CCCCACTTCC TTTTTATCCC GCTGGAAAGG ATGGGAGGGA GCTGCAGAGG AAACCCCTAA CGGAGGCACT TTTTTATGCA ACTTCTTCAG CACGAGTGGT TTCCCAAGTT GACGTTTCAA ATGTCAATTG TGTGCTTAAC TGCATTCTTT TGACGACTCC GTCGTCGTCG TCGTCGTTGG CTTTCCTTAT TTGCCCCGCG TGTGTGTGTG TGTGTGTGCT CGTAGTAGGG CAACCCGTCT CGGATCCAGA TTCCTTCCCA TTTCCATTCC CAGGCCCCTG TCCTTGTCTA ATTTTGGTTT TTTTTGTTGC AAATTGCGGC CTAAGCGGCA TTGGTTGGTA GAGATGGGGT AAGAAGCGGA AAGGTGAGCG AAGGTGGGCA GAGGTCCTCC TCCTGGATAT CGCTTTCGCT GCTAGTTGGC AGCTGGCAGG CACTTGCAGG GAGCACAGGA CTATCACAAT TGATCGACTA TATTATACTG TATCTTCATG TTCTCTTATA AGCAACTAAT ACGGGAATAA TCCGAAAACA AAAGAAACTT CAAAACCAAT CTATTTGCTA AGCTTATAGT TATTTTAATT AATTTACCTC TCTTTTAAGC ATACTCTACT TTTGTGGTTT TTAGTTTAAC CAACTAGTTG TAAACTAGGT AAATTCCCAA GATGCATTGG GTCTTATATA CCCCACTTGA TGCATCTGTG AATGGGCACG CGTAATTTCT TTTCTTTGGC TTTCACTTTG TTTGAGCAAC GTTGCAGCGA CTTTTGCCAA GTCGCTGGGA AAATATGCCG CATTCACACA CACAGGCGCA CTCGCACACA CTCTCGCAAG GAACAGTGGC CCAGAGTCAG CGAGTCAGAC TGCAATCTTG CCTTCAATTA AGCTTTGACA AGTGCATTGC ACACAGGAGC AGGGAGGTTG GGGGAGAGCC CAGAACCGAG TAGTCTGGAT TGGGGACTGG GGAATGGGGC CTGAGACATG GAGAAGAAGT CGCAGGAGCT ACCAGCTGCC TTCCACAAAG CGCATAAATA TGAATGAAGG CAGGACGATG GACTCCTTGC AGTGAACTGG CCAAAAAAAA AAAAAAAGAA GAGGAGAAAA CAGAAGGCAA CACACTGAAA CCGGCCAAAG AGCCCGGAGT GAAGAACTGT AGAAGGAAAC GCAAATAAAT GAATTGCACT TTTCCTTTGC TCGAATTTTC TTCTGGCGCC CCGTTTCAAT GGGCCGCGCC TCAATGGCAG TGGAAAAACT TTGCATATTG TGTTTATTCT ATGCCCGCGG AGATAAAGAG CTCCAAGCTT CGAGCCAGGT GGAAGTCGCA GGCGGAGGCA GAGGCAGGCT TTAATTAAGC GGGTCCAAGT CGCAGTCCGT TGGCATTATG CCCAGATAAT GGCAAGGCCG AGCTGGAAAA AAAAGGGGCC AACGAGGGGC GATGGGCGTA GATGTGGGCG GGGGAAGACA GATATGAAAT GCAAATTATG CGGCGAATTG TGTGCTCATT AATTAAAATT GAACCAAACT GAGGCAAGAA CTCGGCCTGA GAAAGAATGC TCAACCATCA AAGCACCAGC AGCATCATTA GAGCCCGTCC AGCTTAACCA GCCAAATCCT CCATCCTGAA T