Vienna Tile Information
VT ID VT029310
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201348
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 229310
Nearest Genes
Gene Nr FlyBase ID Distance
CG7303 FBgn0041231 0 bp
CG6024 FBgn0036202 14831 bp
Sequence Length 2216
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CAAGGATAATCACTGAGCATTGCAAATACG
Right Primer GATCTGCGAGGGCTTGGATATAGGA
Template genomic
Sequence CAAGGATAAT CACTGAGCAT TGCAAATACG CTAGCAGGTG TATTGCAAAC TACAGACGAT AAGTTTATTT GATGTAGTTA ACTTTGTGCC AAACTGTGAT TAGAGAAAGT TTCGAAGATG CTTTCGCAAA TATTTCGCTG ACTCGGGAAA AGTTCGGTTG GAAAAACAAA ATATATGAGT AGAACTTCAA TATTTATTGA CTCTTCATGT TTTAGTTGCT AGTTCAATAA AGTGGTTAAA TCAGTTTTAA CTTTTTCGAA GTTCTCACTT CAACGAATTT GAAAAGTTCT TCAGCTATAC TTTTGGTACC ATATAATATA TTCAGTTCAT TACTTAATCT ATGTAAAAAA ACATCTAGAC AAGCGCAAGC AACATGACGT ATACTTAATA TTATGTATTC GCCCCAGTAT TCACACAGAT CCAAATCTCG TAGATACATA CTGTAATAAA TAGCTTTGGG GCTTTTATTT ATTATAGTTC ATCAAGGGGT CTACTTAATT AGCCTTCTGC TCAAAAATTT TCCTTGCACC CGGTCAGCAT GGTAATGCCC ATTTAAGGGC TTATACTTAG CATTTCCGGC AGCTCAAAAT TCCCAGACAT CGTGATGCAA ATTTAATGTA AATATTTTAA ACTAATTTTC AGTGATTATG CAAAACCACA AATAAATCTG CAGCAATGGA ATAAACGAGT GGATGCCCAC CGTAAACGTT GGATTTTGGT TGCTGGATGG TGGTGGCCAC AAGGAGCAGT AGCAACAATG GATGGCTGGA GGTAAAGTAA CCGCAACCGG GGCAAGCTTA GTGCGTGCCC CAAAGCGAGG ATTGGACGAA AGTTTCGTGG GTGGGTTACA TGGTGGAGAT GGTAGTGATG GGTTTGAGGA AGGTGGTTTT CGGGGGTCAA AGTTGGTTTT GCTGCTCTGC TCGATGCAGA GTTGTGGCAA AAACTTTGGC CCGAAATCTG TTCGGTTTTC GATCATACCC GCCCACCAGG CAGCCAGCCG CCTCTTTTAC TCCGGATGTG CCCCGGCAAC TTGGCTGCAA CAAAATAATT TCGCTGGCTC GTTTGTCAAA CTAATGGCAG GAATTTGAGC AATTTAAGCA ACAAAGGTTA AACAATGAAT TTCCTGTGCT CCTATATTGA ATTTTACTGG CCCTCGAATG ACCCTCGATG TTCGTGTAAA GTCATTGCCC TCACAACTAT ACACGGTGGC TCTTGGAAAA ATTGGTATGA AATCAAAAAA AAAAGAAGAG ATTCATCACA TGGAATACAA GTTTAGATAG ATGGGCTTCA ATTTCAAAAA TATCAATCCC TTTTATTTTC AGCAAAATTT CCAATTAAGC ATGGTTCTAG GAAATTGTTG CCAGTGCATT GTGGCACAAC CTACGCTCTA TCCACTTGAC TAAGCTGTAG CTACTGGCAT CGACATCTGG TGCCGGACTC ACACGCTCCA TTAGCGCCAC CATCGATGGC ATCTTGGAGG CCATGGCGAT GGCCTGCGCC ACAAGGATTC CCAGATGACG CCTCTGGTCT TTTGTCGCTG CTGTTGCTGC TTTAATGAAA TAATTGAAGT AAATGCCTTT CGCCTGGCCG ACTTCGTCCA TCCAGCTTAT CCGTCGAAGG CGTTTGCATA ATGAGCATAA TCCCCATTCA GTATCCCTGC ATCCTGTCGT TTAGCCTTGG GCCGCCCGGA ATGCCCGTGT CCGTCAAACC ATTCACGTGG CCCATTGAGC TGCGTCCGCC GCCGGTGGTT TGTCAAAGTA ATTGGGCTAT TTAAGTGGCG CATTGGACAG CGCTTTTAAG TTTCGCGGAT ATTTATGTCA GTCGGCAATT ATGACATGTC GCATTAGCTC GTAATTACCC AATGATACGC GAACTACTTT GCCCACTCAT CAGTCATGAA TTTGATCAAA TAAATTGGAC GCAGACTAAC TTAATACGAT AATGATGATT TTTCAGCCAT TTAGAATTCA AGAAATTAAC ACCTAAATAC GAAATTTTGC TTGTAATATA TTTGCTTCAT ACTATTAATA GTATCATATT ATTACGCCTA TTTGCTGTTT ATGACAGCTA ATTAAAGGTA CTAATACAGT AAGCCTGCTA CTCAGTTAAT GACTGGAGTC ACCAAATTGT TTCATTTTAG TTAGTGCCAC AAAGCGCACC ATATCGATAT GAAGATCTAC CAGGATATAT ATCCTATATC CAAGCCCTCG CAGATC