Vienna Tile Information
VT ID VT049500
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201324
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 249500
Nearest Genes
Gene Nr FlyBase ID Distance
CG12048 FBgn0039675 1924 bp
CG18741 FBgn0015129 1925 bp
Sequence Length 949
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer GAGTCCTTGCTGCCTGCCTTTCGT
Right Primer CGAACACACGTTAATGACTTCCGCCT
Template genomic
Sequence GAGTCCTTGC TGCCTGCCTT TCGTCCTGCC ATGGATTGGA TATAAACAAA ACACCTTTCC GTTGGCCAAA CAAGTCGGCA GCCTTGGCCG TTTGACAGCC CATCGATGGG AGGTGGGCAA ATCTTTGCTA ACCGCCGGAA ACGGAAATGG AGAGGAGGAG GAAGCAGAAG GCAGCAGAGT AAATGTTGCA AATGCTGGCC CATCAATCAG CCAAAATGCT GAAATGGCAA GATGGCAAGA TGGCAAAATG GGCTCATGGC TGGTAATCCG CGTAATATTA TTAAATAATT AACACGCGTT ACTGCGCCTT GTTTATGACA GCTTAGCGAC CGGAAGTGAT GGCGCCCAGA CTTTTGTCTT CCAAGATTTA GCCATCAAAA GATAAACGCA ATTACGGAGC AGTTTTCGAG CATTTTGGAA CCGTACGAAA GACAAAGACT TTGCGGCGCG GCGAAACATG CAAATTAGCG TGCCAGCGAA CGAGTTAAAG TTCGCTTTTG AAAGGAATTT GCATATTTAA ATGGCATTTG CGCCAGACAC TTGACAGTCT AACTGGCAGT TGGCAACATT CACTGGGTCC TGGTCTTGCT GCTCCTGCTC CTGCTCCTGC TCCTTGATCC TGTCACTCCG GTGACAGTCG GTGCCTCGTC ACGTTTCTGT TGGCTCATAA AAGTGAGATT GAATTTTGAA CGGGTGGCCC ACGAAAGTCC CTCCTTTCTC ATTCGCAATC GCCCTAACTT TCTGCCATCC CGGGTGTCTG TGCTTAATAG GCCACATGAA CTTGAATCCA CCACGCCACG AGGAGATGAT GATGACGCCT CCGACGAGGA TGCGAAATTG TTGCACACGC GCAGGAACAC AAAAACCAAA GTTAAAGTGA AAGTGAATGT GAATGTGAAA GTGTGCCCGA AAGTTTCTGG CCAAGGCGGA AGTCATTAAC GTGTGTTCG