Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT064887
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201312
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 264887
Nearest Genes
Gene Nr FlyBase ID Distance
CG1829 FBgn0031126 3703 bp
CG34145 FBgn0083981 37496 bp
Sequence Length 2111
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GAAATGGCCTGATGCTCCGAAAAA
Right Primer GTGGAAACGGGGAAGGGGAGGAG
Template genomic
Sequence GAAATGGCCT GATGCTCCGA AAAAAAAACA CTCTCGAAAG TCAAGACACA TAATCCCCAT TGTGTTTTTC GCTCGATTTT TACTAGTTCC GCGTAGTTTG CTGGAAAATC AGACGGCAAG CGGGCAAAAA ATTAGCCAGA AAAATCGATT GTCATTTGGG CATTGCTTAA CCCATTCGCT GACCGAGTCA TAAAAAAATC TCACACAAAA AATGTGCACG CATTTTTTAA CCCCTTGTCC ATTGCCCTGA AAATATAAAA TGAAACCGAA ACCGTGTCCT GTTCTCGTTC CACATTTACT CCTTTATCTC TAATTTATGT CCCGCCCGGT TGTCCTCTTT TTATGGTTTT ATTACTATAC GATCTTGCTA AAAAAAAAAA AAAAACAGAG CGAAAAAACA GCAGAACAGA AATCCGACAG ATACTTCCAC TAGCCTAGCT ACATAGTGCT GTTAGTGGCT ATAGATATTA TGCCTATATG ACACTGATCC TATGTGAAGA TGAACGCTTT CACGCACGTC CTATTTGCGC ATACAAATTT GCGGACTTAG TCGTGCGTAT AAAGCACGAA CGTATCTAAA AATAAATCAA TTTGCCTATA ATACTCTACA ATTGGTTATA AATTATAAGA TTTAAGTTTG AGTCATTTGT GGAATGCAGT TCACCTGAAA AGTCATTGGG GTGTAGTGTC ATACGGTCTT AAATTTGCAT TGCCATAGCA GCAGGAGTAA TAAAAAGACT CGGGCCGCAG GACCAAAGGA CCTAAGGTCC TTTTGCCTGT ACTTCCTTAC GCCCGTTTTT AACCCCTTTT TTGCTCTACA AATACAATTA CAATTGTTCG CGCTCGCGAA AAGGGGTTAA GGCGGGTAAA TTTCAAATTT CACTGACCGT TTTTACCTAA ACTACCGAGA ATCGCGTTTT ACAGTCGTTT TTTGTGCCCC TTCTGCGATT TTTGGTTGTT TTTTAGGATG GGTTTACTTC TTACTTAGAA CTTGACCCCA TCTATTTAGG TTTATAGGTT TCTAGTGCAG TTTTTTTTCC AGTTTTTTTG TTTCCAAATT TTTTGTTCTT TATGGTACAC ATTTTTAGCA TTTCGCGGAA ACGAATCCTT TCTCTAAGTT GTTTTTAATG TTTTGGAATT TTTTCTTGGT CGGTTCTGGA TGATTTTTAG CCGCTTCCTT TTGACTTTGC ATTTGTTGGG TTTGACTTTA TGACTAGGTT TTCGGTTGAG CCACAGTCAA GGTCTAACTA GAGGCTCAAG GTCGACTGAA GCACCCCACT CATCTGTAAG GAGATGGTAA TTGAACTGCA TATTGGTATA CTTATATTTA ATGCCTATCT ATTAATCAAC AAGCTTTGCT AAAATCATAT TTCGCACAGT TAGCAGAGTC TTCATTTAGC CTTCAATTTA CCAAGCAATT CATACTGGAA AATTTTCGAT TTATGAGAGT GTATAAAAAA TTGAAAAAAC GTAGAGCCTG GCAAGACTTT GCCATTTGTT TGTATTTTGT TTTTTTTTTT TTATGTGCTC AGTGCCCCTT TACTGATTTT CCTGTTGTGC AATTTACTTT CATCAGCCGT CTGTCTTGAA AATATCAAAA CAGTGTAAGG GAAATTTGCT CAACTTAGCT GCGCATCATT TAACTTTGAG CAAAAACGAG CGGAGTGGAT TACACACATG AAAGGGCATT CAAAAAGATA CATCGAATCT GTATCTTTTT CGGCCAGAAA ACGGAAAACT GGAAAGGGGA AAACTGAGGA GTAATCGAAA CCCGTCAAAA TGGCAAACAC AACAATGCGT CTTAGAAACG AGCTGAAAAG GAGAAAGGTC CTTAAGAACA TTACACGATC GCCGAGTAAC ACACATGTGT ATCTCTATCC GAATCCGAAG GATCAGCTGC TGCTGCTCTT GCCTTTTTTC GAGATTATTA TTAGCGCAAC ATTAACGTCA AATTACGCAT CTATTTTGCG CACTTTATCT CGATCTCCCT ATATGCCACA TATCGCATAA AAAGCGGTTC AACATCAAAA AAAAAAAAAC CTGGGAGGAT TACCCCCGGG ATTACGATTA CTGGACCATG TGTGTGCGCT CCTCCCCTTC CCCGTTTCCA C