Vienna Tile Information
VT ID VT058699
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201299
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 258699
Nearest Genes
Gene Nr FlyBase ID Distance
CG2302 FBgn0015519 15320 bp
Sequence Length 2133
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GTTTTCCCTTGCATTCGACATTTTATTTTT
Right Primer TTTCCCATTTTCCCGCTTCTCGTTT
Template genomic
Sequence GTTTTCCCTT GCATTCGACA TTTTATTTTT ATTGTTTCTG CCAGTTTTCC TTTGATTCAA CTATGCAAAA ATGATAAACT GGACAGATTC ACGTCCGATC TGATCGTGTT TATCGGATGG TTGCACTTTG CGGTGAAATC AGAGCAAAAA AAAAAAGCAG CGAGCAGTCC GACTTTTTGG GGGCAACTGC AAAGTGCAGC TGCAGTCGAG GGCCAACGGG GCGTATGAAT AATAAAACAT TCGCTCGCAG AAAAAGGAGG TTTGCAGAGG GTTAAGGGTC GCTGCCAAAC AATGTGAATG ACCAATGTGG GAATTTCGAA TGTGGGTGAC AAACTGGCCG CGTTTTGTTA ACCCGCAATC GCGAGTGGAT TTCCCATCTC ACCACCAACT TCACCCCTTT TGGCCAGCGG CATTTGCAGG TGGCACGCAC ATTGGGCAAA CAAACGAAAA CCTTCCACAT ATTCCACCAA TAAAAGCGGG CAACAAAAAA TTGCGAAAAG AATGAAACAG ATTGCAGATG AAAATACGCA GGAAAAAAGG GGAAAAGCGA AGCAGACAGC CACTGTGTAA ATATAATATG AATAATTTTG TTAGTCGCGT CCCCATTTTT TTATACCATT TTTATACCTC TTACTAGTAG GGTGAAAGGA TACACTAGAT TCGTTCAAAA GTATGTAACA CGCAGAAGGA AGCGTTTTCG ACCATTAAAA GAATATAGTA CATATATTCT TGATCAGAAT CCATATCGGA GTCGATCTAG ACATGTCCAT CTGTCCGTAC GAACGTCGAG AATTTTTTTT ATAATTTTTT AAATTGTTAA TCATTTTATA CCCCAATATC TATTGATATC CCAGAAAAAT AATGAAATTT CGCGTTCGCA TTCATACTAG CTCACGCTAG GGTATCTGAT AGTCGGGAAA CTCGACTATA GCATTCTCTC TTTTTTTTAT GTTGGGGGGA GGCCAGAGCA AGTGACCCAC GAAGATGGCA CAGCATAAAA CGGTTTAAGG AGAAAAAAAA ACAAACTAAA TGAAAGTGCT GACCAAGTCG CATGTGTGTG CTTTTGCGTA TTCCAGAAGG CATCTCGCTT TTTGGTAAGG ATGGCAAAAT AAATGGTTAT ATTTAAATTC AAGCACAGAG CTTAATTAAA ATATTTGCCA AAAGAGGGAA TTTTTTCAGT TACGTTTTAG TGCGCCACAG CCATTTTATA ATGTTTCTAT CTTGGCTTTA AGTTTAAACC AAAGCTCAAA AGACGAGTGT AGATGTTAAT TTTTTTGTTA TATGCAAAAT GTCCAACGAA TTTATATCCA TTTTCAGCGG ACGCATGGAT TGTTTGCACC CATTTTTCCG ATGGCTTTTA CCCACTTTTC CATTGCCCCC CCCCCCCCCA CTGCACTTGC CTGCATTCCG TGTGGAATTT GGGGCATCCT GTTTGATATA TTCTCGGTGA TATGACCAAT TACATGGCCA TCAAATGCAA ACGAATGCAA TCATTCACTA ACTGACACCC TGTGCCAGTT GCCCCACCAT ATCCGCTTCC ATTTCTCCAC ATTCTACACT TTCCCACTTT CCACGCCATT TTCCATGCTT TGCCTTCGCC AGTCATCGTC ATATCCTTGC TGGTCCTGTC AGGGGCGTAA ACGCTGCGTC CGAAGCTTAA ATGGCAATAT TTTTGCCAAG TGTCAGGCGA TGCCCATCAA CTAGCCAACA CACACGTACG CACACACACA CACACAAACA CCCAATACAT CGCAGCCATT TGGAAATACC GAATTTCATT CGTTTTGTAG GTGTTGCAAC CTGATGAATT GAGCGTAGAG CACGTGCATG ATCCCCATCA TCATTTTTTA TGGCCATGCG TCAAAAAACG AACAGGAATT ACCAGTAGCC CCCTGCAATC TAGCCTTTAA TACCATCTGG CAATGGCAAT GTGTCAAAAC GAATCGGGAC TTCCCTACGA TGGCCAAGTG CCGAAAAAAA CAAAAATAAA AAAGAACAAC GATCCAAAGT AGTCGCAGTT GCGGGGGCAG ATCGGATTTC GTTGGTGTAA GGAACTTGGG AAAGCGGCGG AAACAGGAAG TAGGAAATGT CGACGACACG CACACTCGAA ACGAGAAGCG GGAAAATGGG AAA