Vienna Tile Information
VT ID VT048569
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201288
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 248569
Nearest Genes
Gene Nr FlyBase ID Distance
CG12426 FBgn0039552 15440 bp
CG5017 FBgn0039553 22455 bp
Sequence Length 2165
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TCAAAATGCAAACTGTCAAAATGGAGC
Right Primer ATGCGATAAGTCCACACACACGACA
Template genomic
Sequence TCAAAATGCA AACTGTCAAA ATGGAGCTGT TGGAAAATAT GAAAAAAAAG AAACAAAATA TAAAAGCAAA CAGCTAGTAA CAAATGAATT AGCCATATCT ATGCGCCTAG TGTGTGTGAG TGACGGCGTG ATAACGCGTT ATTACACTAT AAAATCATTA ATATGGCGGC TCTAATGTCG AGGATATGTA AATGCAGGCG CTGTCACGCG AAACGCTTAT AAAAAAAATA TAAAAAAAAG TATAGACAAC GAGCCCTGAA ATGCGGCATT AGCTGCCTAT AGACGAGATC CATTGACAAC GCCTACCATT TGAGCCCATT ACCCAACACT TTGGCAATAA AGTCGAGTGT GTGCCCCAGT GCCAAGGCAA CGAAATCTAT TAGTTTGCCA AGGCTTGGCG GGAATTCCAG CAGAAGAAGA GGTGGAAGAG CTGCGACAAT TCCGTAAATT TGATATGCGC AATTTGTTGC GAGGACGAAG GACCAAGGAC CAAGGACGAA GGACGAAGCA GCCTGGCAAC CTGTTGCCGC TTGTTACGCA CTTTTATGAC GCCAGCGGGT GGGCTTCGAG TGGATTGCGT GTGTGTCTCA GCCCAACCCC GGTAGAAACA ACCTCAAAGT AGTCCCCATT AAAGGTAATA TGCCACATGA GTCGCTGATG GAACTCACTC ACATTCCTTC TGCGGATTGC CATAACATAT TCACAGGGAA GTTATTCTGA GGACTCGAGA ATTCGGTCGT AGACCCCTCA ATATTCTGAT TCATAACCTT AATAAAGGGG TCGTAGAAAG ATCTAGTTTG CTCCACTATA TTTCAACAAG GTGGAATAGC CCCATTTTTC ACTGCATACT TTTTGACACC TAGTGAGTAA TTGAATGTTT TAAATGGGTT ATCAACTTTC CAGTTATTTC AACTATGAAA TTTAATTTAA AGAACGCATT TAAAGTAGTC TAAATCCTTG CTAAGATGAG ATCTCAAAAT TTAAGCTAGA AATTTCTCAG AAAGTGCGCT ATGCTTATTT CATATTGTGC TGCTGTTCAT TGCAGTTTAG CATTTGATAT GCAGAAAAAA AAAAGTGCAT AAGTTTTTTT CCAAGGCTCC GATATACTTA TAGTTTATAC TTTGGCAAAT CTCAGTTCAA GACAAAAGTA ACCAACTCAA CTTGGAAACT TTCCTCTTTT TTTGTGCTAT TTCAGTTGCA GCTTTTGGCA TTTCTTATGC AGCTGATTGC ATTTGGCCAA GAGCAAATTG CAGCAAGAGC AGCACAAGGA AAATGCAGCT GCAATTGAAT TTTATAACAA ACAATTTTAC GCTTTAAGCA CACTAGAATT TGCTTTTGTT GTAGCTAGCT ACCAATGAGG CTGCTGCCTT GAAGTGGCCG GAGTGCGTCA TTGACTTTGC CTCTGGCCGA AGTCACTTTT CCACTCTTCT TTTTTCCTAT TTATCGTTAT TTACCATTAG CTGGCTTTCA CCTACCTCTC TCCCCACCCC CCACCTCCCA TCCCCTCGAC CCTTTCGCCT GCAGCAAGGA CCTGACTTTC CTCGGACTCA GTAACGGCCA CACAATAAGC ATTCTGGCCC AGCTACTCGG GCTCGCCTTT ATTTCCTGCG GCTTCCCCTT TTGCAGCCTT GAGGGTAATC GCTGCCCATA AGCAGGCACA AAGTTTAATA AAAAATAGCA GAACAAAAAC GAAATCAATT CACCTAGCCA GGCAATTATG CAGCAGCAAG TTGAGAAAGT AAAAAACTTA GTCAAATGGT TCTCAATTAA GTTAAGTTTC GGCTACAGCA AAGCAATATA GCTGAATGGC TAGACAAGTT TGAGAAACAA ATGTCCAAGC CGATGAATGT TAGTATAAAA AATTTATAAA GTTGAATAAT AATCCCTTTC CTTAAGTAAT ACTTTTTTTT ATAATTTTAT TGTTTTAATG TAAGCATTTC TGCTCAAAAC GAAATATGTA TATACAAAAC CAGGATTTCA ACAATTAAAT TTAAGACACT TTATAACTAC ATTTGCAAGC TTCAATAAAT AGAGTTTTAA TTGTGTCCCC GGAATAACAG ATGTTCGTGT TTAAGTTCTA AAAATGTTCG CTAGACTTTA ATATTTGTTG TATACCAAAA GATACATTTG CTTTATTTAA TGTCGTGTGT GTGGACTTAT CGCAT