Vienna Tile Information
VT ID VT043284
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201277
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 243284
Nearest Genes
Gene Nr FlyBase ID Distance
CG16766 FBgn0038541 1656 bp
Sequence Length 2110
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CAATATGTCCGCTTGGCTTTTGTTTTT
Right Primer TGGGCAAATTGTCACATACATCCACT
Template genomic
Sequence CAATATGTCC GCTTGGCTTT TGTTTTTTTC CAGCATTTCT CTGGCCATTT CCGTTGCGTT TATTGGCCCG GCTTTTATAA TTTCCTCTTT TTCACCTTCG TTTTTGTTTT ATATTTCGCA GGTATCTCGC CGTCACACAA CCACTGACGT ACTCCAAGAA GCGCCGATCC AAGCGACTGG CCCTCCTCAT GATTCTCGTC GTGTGGATAA CTGCCCTGTC AATCACATGT CCACCCTATT TGGGCTGGTA AGTTAGCGCC AGCTGCACGG AGAACAAAAT CAACCTTAAC CCATGATGGA TCGCCTATTC ATCTGTTAAG AAAACCATTC ATGTTATAAT CATTTAATTG AACGCATTAA ATTGGGTTGG GAGTACAGGC AACATGTGAT AATGATCAGT ATCCAAAGGA AGAAAAATAA TATATTTAAT ATCATATAAT ATTATTAATA ATATTATATT ATAAATATGG CCAAGATAAA TTTATTTGTA GTGCTCTATT AAGTTTATAG ATATATATTT TTTTGAATTT TGTAATATTA TTTTCACTCT TTCCCGTGTA ATTCGAAATA TTATATGTAA TATTTTTATT GAGCACCCAT TTTTTTTTTA CCAAATTTGT CCTTCCGGAG GCGTGACAAT ACTTTGTGGC TTTTTGTGGC TGAAAGTCCT GCTCGCTTTT TTTTTTCTTT TTTGAGCTAA TGGCTGTGCG GTGGCGCAGC ATAGATAATG TGCTACAAAA GGGTCTCGAA ATACACACGT TTATTTATAT TATATTTGCG CCTTTGGCTG CGCCTAAAAA ACATTACGTA ATTGACGACG GGTTGTTGCT GTTGCTGCTG GTCGTGCAGC CATTACATTG AAGTTTTAAT GAGTTGTTAA TGACTTTGTT TGCCGCGGCG CATTTGCTTT GTTCTCACCT ACGCACACAC ACTCAGCGCG AAAGCCGCAC ACTTGTGTGT TGCATACTTC CAGGCGCCCA AATTAACCAG CACTCACTCA CACACACTCG CACTCACTCA CACACACCAC AAAGCCAGCA TGTCCTTAAT GCCATTGGCC ATGGCTTAGT TTTGGCCCCC TTTGGCTGAA AGCGAAGAGC ATGGCTTAAA GGGCACATTA AAACGGTCTG AGGCCGAATT ACAGCCACAG CTGCAGGACA TTGGAAAATT TGGAAAATTT GGCGCTGGGG GAAAATCGCA ATTATAAGCG CCAGCAGATG GCGCCACTTA CATATTTTCA TTCTTTAAGC GGACTAGTTT TATGAAAAAA GTTTGCAAAT GCAGCGGTTG CAACAACTGT TTGTTTTACT CACAATCTGT TATTTGTTAT TGCCTAATGA ATACTAAACT GATTGTGTTT GCTTGCTATT TAAATTTAGA TTTAACTTTT GGCTAATTGA TTTAAGCATT GTTTATTTAG TTCATTTTTT AATTTAACTA ATGCATAGCT AATGTATTAA ATTGCCCTCA ATTTCGGATT GAATAATTAA TGTTAAACAA GAAGTTTAGT AGGAAAATCG GCTATTTCCA TTCGGGTCTT GTAAATACCA ACCTTAACAA AGTTGCATTT GTACAATTAT ACTGTCAGGT TATTTTGGTA TCGGGTAGCA GTAATTACCG TGAGTTTTTG GATAACACAT ACTTGGGGTA ACAAGCAGCT AGTTTAGTTG AATTACAACA CCGGAAAATT CCATTGACAG TAGTGACAAT GAGGCAATAA ACTTTTTGAA AGAGAAACAT TATAGGAAAC TGTGTATCCA GTGGGCGTGC CCCAAACTTT GGTTGGCATA TTTGTAAAAA TTGGCCATCC AAAAAATAAA TCAAAACAAC TGGCAATCAT TTTATAATCG TGTGGGCGTG AGTCTTTTAG GCGATTGGGG GGCTTTAGAG TGGGCGTGGT AATGTTCTGA AATAAGCTTG TTCCCGAGAT TTGGACTCCG GGGGACAAAT GGACATAACC GAATCAAGGA TATATATACT TCATGCTTCT GTCTGCTACA TGATATTCAG TGAACCTAGT ATTCTAAGAA TAGTGGGTAC AATAACCCAG TATGAACTGG AAGAAGCTGA ATCTTGCCAC CTACAGTGGA TGTATGTGAC AATTTGCCCA