Vienna Tile Information
VT ID VT016256
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201231
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 216256
Nearest Genes
Gene Nr FlyBase ID Distance
CG12464 FBgn0033861 5056 bp
CG17716 FBgn0000633 6670 bp
Sequence Length 2187
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CATAGCTGTCCAAAAGTATGCAACGGA
Right Primer TTGGTAAACCTGACATTGCGCCAGA
Template genomic
Sequence CATAGCTGTC CAAAAGTATG CAACGGAATT TGTATGCGTT TTATAGGTGT TTTAAGTTAT GCACAGTAAC TTTGTATGTC TGCTGTTTAA AGGATTCTTT GAATTAGAAA CACCACTGCT CATATATACC TAAATGTGCA TTTTTCAGTA CGTTCACAAA ATTTTCTTTC AGTGTAAGGC AAGTCTAACA AACACAGAGG AAAAATGAGA TAGAATGAAG CAAGGCGTGG GTGGAATGGA AACCGTTTTC GGACGGATTT ATTTGCTTAA ACCCAAAGTA AAAAGTTCGC TTTGGCTGCG TGGCACGCGG TAACTGTAAT TGTCATTATG CCCCCGGGCA GTCAGCCCAG TTACTTACTA ACCCCTTGCT GCCACCACCC ACCGTCAACC GCCCACCGTT CACAAATCGC GCCATCTCTT TCTGCACCGC TCCAACTGCC AGATGCGGCA TCTCTTTCCG TCGCCGTCTG GTTGCCTTTG GAATGTTTGT CTTTGGCTTG GCAGCAAAGT GAAGGCGACT TGAATCATTT TTAACCCCTT CGCAACCCCC TTTGAGCCCA ACCAAGTGCT TTTCATATTT AGACGTGCTA CTTATTTTAT CCCCGCTGCC AACGCTTCTC GTGCATTTTG CCATCATCAT CTTGGCCATA ATAATCATTT AGAGGAAGTT CGCCTGAGTT ACTTGGCACA CTCAACAAAG TATCTATCAA TATTTGCATT TAGAAGTTCT TTGCCTTCTG GCTTATTTGT TGAGTTATTA ACTGGAATTA GGAAAATTGA AATGCGTTTT CCGCATAAGA GCGTGAAATT AAGGTTTCCA CCCGCACGCA ATGGCAATGC CAATGGCCAA CTTGGGTACA CTTCGCTACT CTTTTCGGCC AGTCGCCTTA ACTTTTCTAA TTATGCGACA CGATAATTAA CTCAATTTGC TCTGATGCGA CAACAACAAG TTAAAGAGCG CCAGTGGAAA CAAAAGGCCA GGAAAATGTC AGAATATCTC CTACCAATGT GCAATGGCCA TGGCCCAAAA CAGTTGGCAA GCCGCCGAAA GAAGTGACGG TTTGAGGGGG GAGGAGTGGC CATAAAATGC CATAAAAACC GCCGAGTTGA GCTGAAGTTT CCAAATTGCT GCTCGATGTG GTCGGCTGGA AACGGAGGTC CTTTTTTCCT GTTCAAATTT AGCCGGAAAA GCCAATGCCC ATGGACCGAA GTCAATGGTG TATATGTCCT TCGACTGATA TGTCCACCAA TGTCAATTTT TGATGGCCTT TTTTTTTTGT GATTTTATTA GGTGGAAATG TTTTGCTAAA GCAAGCTACA TTTTACTGCG TATATCTTAA AAAAAAAAAA AATTGTATAG AAAAACAAAA CCTGTTTCTA ACAAGGTGAA TCTCTTAAAT ATACATTTCT GTAACAACTC TTGATGGAAA GACATTAGGT TCATAATCTC AAGAACATTT GCAATACATT TACTTTACTA GATTTTATTG GCTATGCCAA ATATAATACG AAACAAGTAA TTAATTTATC TTTGATACAT TTTTCGCAGG CTTATCCTGC ATTGAAGGAG TCTCAGTAAT AAACTACCCA ACTCATTAGC AATCACACGA CCCAGGGTAA TCCCCTCAAC CGACAGACAT ATTCGAGGGT TAACCTCAAG TGCCTGTGCC CCCATCGGAT TGAAGGGCTC CCAAATGTGC GATTGTCTCC GCCAAACTCC AGAAGCCCGA ATTTGCGTGT GGCAAGACCC CGAAATTAGC CCAGTCACGG CGCCAGCTGA AGCTATTAAA AATTGTGAAA TAATTTCCAA GCACGCTCCA ATGGAGCAAT TGGGGATTGT CGCGGAGTGT GGCTGCAATT ACTTTGATGA TGACTGCGGC GCTGATGATT ATGATGATGA TGACGCGCAC GTTACTCGCG GCATGCAAAT AACATGCTAG CACCCGAAAT CCTCGACTTT TACAATGGAT AGCGAAAGTC AGCAGATCAA GGAACGCACC CCCAGGATTT CCCCAGGATA TCCAAGGACT AAGCCTCTAT CAGCGGGTGG GCGGGAAATC TCTCGTGTCG AGCCTTTAAT CAGGCCGCAT TATTATTATC AGCGAGCTAT GATATATAGC TATTTGTTTG ATGACTTCGG GTGTGTTTTT TCTTTAGGCA CATCTGGCGC AATGTCAGGT TTACCAA