Vienna Tile Information
VT ID VT003275
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201207
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 203275
Nearest Genes
Gene Nr FlyBase ID Distance
CG31637 FBgn0051637 2918 bp
Sequence Length 2121
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGCCTCCTCTGAAAAGCGAAAAACA
Right Primer ACCAAAACAGCAATAGTAGCGGGCA
Template genomic
Sequence CGCCTCCTCT GAAAAGCGAA AAACAATTAA CACACTAAAT CATGAGCTGA CTTCGTATAC TTTAGCCGGA AGTTGGGTCA CTAAATTTAC AAACTCTTAA GGTTTAATTT CTCTTTTGCC CTGCTAACTT TGTTTTCCTA GTTCGACTCC TCCTCCTAAT CTATTTTCAA CCATTTCGAT GCTGACTATA TGCTTTTATC TTAACTTGTT TACCTTAATT AAAAGAGCAA GCTTATTATC TTATTTTTTT GTGCTTATAT TAGTAACCAA GACTTGCAGA TAGTAGTTAA AACTGCAGCT TTGTTTGTTT TCCGATAACT TTAAGCTCTA TTTCAAATGG AAAAGTGCTT CATAAAATTA GCTTTGTATA AGCACTTTGC ACTTAAGTTG CGCCTCTCAC TCAATTCTTT GTACTCTCCT TCGCGGACTG CAGTAAAAAT TCTTTCACAC TCTATTAACT TGGCCCCGCT GGCCGCTGGC CGCTGGGAAA TGCATCAAAA TTCCGGAAAT GCTGACCAGC ACTTGGATTT ATGTTTGCCT GCGGGCCAAC ATCATCCCAG CCAGCCACAC ACTTAGCCAC AATTTGGGTC AGTGCGAGCA TTGTGGGGCG AAAAGCCGTG TTTGGTGAGT CACTAAGCGA CCGCTAACTT GGCTTCTAAT TGTCGATTGG CCAAGTCTTG TGCCGGCTGG GTGTGCCCAG AATTTTGTTT TTTGGGGGGG AAACTGGGCG AAGCTTTCCC ACAATTATCG CGTATACGCC GTGTTGGACG GTCTCTTAAA TTTAATGCCC AATGAGCATT TCATTTATAA ATCACACATT ATTTTTATGT GATTTTTCAT GGTCTCCTTC CCGCCACTCA GTTGCGATAA GAAAGAAAAT GTGGCTAATG AAATGAACTA CCAAATGGGG CAGTTGTATA TTTATAAGTC AATGAGTCAC GAGAATTGCA AAATTTATCA TTACTACTAC TTCCATTGAG CACTGAACGG TTTGAAGCAA TCACGGAATG TAAATTGTAT TATTTTATTA TTAAATCATT TCACAATAAG TGTAACTAAA ACATAATTTT AATGAAAATT GTTCAGCTTA AGGTCGGGTT TTATTAAATT TCTTCACACT GTTGGAAAAG CCTTTTCATT TAGTTTTCCC CGGCGCGCTA CGGTTTTGTG GCCGCTAACT TTGAGAGGCT TTTGCCAGCA AGTAGATTAA AATTGTGAGC ATTGAATGCG CCCACCACAG GCCGCACAGT CGGAAGATGG CGAAAATAGT TGCATTCAAC ATCTGGCAAA AGAACCAAAG AGAGCCGAAC GAGCCGAAAG AACCGCAGAA GCCACAAAGA GTTTGGGCCC AGTCAGTTTT AGTTGGCTTA TAATGAGCAA AGTGGCCATT AACTCAAAAA CTTTTCCGCG CTGCGTTTTA AAGCGGGCCA AAACAGCCAG CAAACAATAT GAGAACGAGA CGGAAGAAGA AGCCGCTAGA CGTCAAGACC CCGCGGTTTT TGGCTGCTGT AAGACCCGGT TCTCGGAAGC CCATTGCGCC ATAGACCTCA TTCTGGGCCG TTTATCTCGT TTTGAACCTT TTGACTTGAC AGTTTTGTCA AAAAGAGAGA GAGAGAGAGA GAGACGGCTA TGGACGGTGC GAAAGAGAGC GATCGTGAGT TCAGTGAACG TTCAAGTAGA ATAGTTTTCA TGCGCAATGC GGGTGTATGG ATTTCTTTAT AGAAGTAGAT ATATTCACTA GGCACAAACA AAAGATGTGC ACTATTCACA CTTAGCATAA AGATAGTAGT TTTCTTTTTT TTGACTAGCT AATTGAAATT GGAGCATGTA GAGCTAGTGT AGCTCATGCT CAAACGAGTA TATTAATCTG AACTTTCTTT TCGAAAACAG CTGACATGTT ATCAAATCGC ATTTGACCGA AATATAACTA GTCTGTCAGT CAGTGTGGAA AGAGCATTGA GTGTGCTAGT CTATATTTTT TTCCATTTTT TGTGTGTGCC CCAAACTTTG TATCTTATTG CATTTGCAAA AAAAGCGAAA CGGGTTTCGT TGCTGGCTAA GCCAAACCTT TTTCTTATTT ATTTATTTTT ATTTTTTGCC CGCTACTATT GCTGTTTTGG T