Vienna Tile Information
VT ID VT040556
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201129
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 240556
Nearest Genes
Gene Nr FlyBase ID Distance
CG42244 FBgn0250910 1672 bp
Sequence Length 2146
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CACAGAAAGGGGAGTTGGTATCGGAG
Right Primer TGGTGCTGTTACCTGTTTCAAGCAGAA
Template genomic
Sequence CACAGAAAGG GGAGTTGGTA TCGGAGAAAC ACTTTTTCGA ATTAAGTTCT TTTTGCTGCT CTGATTGCTT TTTGTGGTTA CTTTGTTTTT CCTCGATTTT GCACTTTGTA TCTGCTTTTG GCTTGTGCAA TTGATATTTT TTTTTATTAA AATTATCATC GATTCGACTG CAATTGGTGT GCGATATGAA ATACAAGACT TGTGGTCATC TGCCAAACGA GTTTGTTACA CCAAAGTTGC AACAAAGTGC GAACAATTTG CGGTTAATAA AAACCATTAT CAGCAATCTC GCACAGAACG TTGGTAATTG AAAATCAAAT ACGAAGTGTC AGTGCAATGA TTTCTTGTTG TCGATACACA GAGTACACGA AGTTTCCGAT CGATTGACAA TATTCTTTAA TTAAATTTTC AATCAAAGCA TTCAAATCTC TTACAAATCG CATCATTACG CCAGCTATGA ATTTGATTAG CTTATGCCTA AATCCAGACA AACAGACACG CCAATCGGAA CAACAATGGT ATGCTAAAAT GGCTCAAGGC ATTCATTCTA TTCATCATTT ATCCAGGCAT TTATCGGGAG ACATTCGAGA TGCCTTCGTA GGCCAAGGGA CCACCCACTG ATGAGATATT GCCCGAATAA ATGAAGGCAT TTACATTTAA AACATTTATG CGCAAATATT TGCCGACCTT AAGGGCCATA TTGTCTTACA TTCGGCATGG GGTAACGTTC TTTGCACACA AAAACCGAAA TAGCAACAGA ATCAGATTCA GAATCCGAAT CCGAATCTGA ATCTGAATCT GAATCAGAGT CCCAGTGAAC TCGAAACCAT TCGAAAGTTT CCAGCAAATA AAACATGCAT ACACGAGCAT ACGCATGTAT GACCAAACAA TCTGAAACTC GACTGTATTA GTTGAATTCA AACTTTTTCG AGCGTAACTT GAAAAGTTTC AATTTGTGCA TGACAATCGC CGTCTGTCAG TAGTCCTTCT CCTCTATCCA ACTGTCTATC TGTCGGCGCT CGTACGTGTG GGCCGTATGT CATTTTAGTG TCCCTGCGAC ACTAAGAAAA AAATAATCCT CCAAGCACTT TAATCTTTAC AAAAAATATT ATTTGTATAA TAAGTCTTAA CTAAAAACAT GGTATATCGT TCAATAAAAC ACATTCAGTG TGCTCAGCTA TCTCAGTTTT CCATAAATAT TATTACTAAA AAAAAGTCAT CCTTGTTTAT TTCCACTAAA ATCCTACACA TATCAGTTTC GTTGGAATTT CCAAAACCTA CAAATTGCTT GTAATTTCTC CGAATCCACT ACAACCAACT CAATGTTATT TCATAAAATG TTTTCGCCAT CTGCACAAAG TTTAGAAAGC TGAGTAAAAA ACTTTCTTCA ATTCAGAGAA CGAACTGTGT TACCAAGCAA TCGGCAGAGA ACTTTGGGGG GCTTTTGATA AATTTGATTT TAAAGGTGGC CCGGTCCGAT TTTCAATTAA ATGCAAGTGC ACTCGTAGGT GCAAAATCGC AAGTGCAGAA AATCGATAGC CAGACTCAGG TGGCGTGCTA GTCGCCTTGG CAAAACCCAG AGGCTTTGCG CTAGCCAGCC AGTTCATTCA CGAATGCGAA AAAGGCCAAA AGGCTGGTGG CCAAAGGTGA GACACTAAGG GGTCCAATTC GAATGGGAAT GGTTTGGGCG CAGTGCCGTC GGCTGAGCGA ATCAAGTGGC AAATGCCAAA TGGCATCCTG ACCTGACCCA GCGGCCGTAG CAAGAGGAGA AGGCGAAGCA AGAGGAGCAG GAACAGGAGC ATCAGCAATA GAAGCCAACT CAGTGGAGGA ACTCGACCGT CGGCAAATGG CACACTGTGC ACCATGTGCA CTGTGATACG GGAATGGAAA ACTAACGAGA GGAAATTGTG TTTCAGAAAT GCAATGAAAA ATTATTGCCG AGCAGTGAAG CGGCACGGAT ATTTGTCGCT AGTTGCTACA AAAAATCATA GGAAAGCGCA TCAAGTCGGG TAAAAAGGAG CTGTGCATGT GCACAATACC TCACTGAATT ATAGCAATAA ATGTGTTTCG TATAAAATGT GAAAGTAAAT GGTGCGAAAC GAAGTTTAAC TTATGTCTAT TCTGCTTGAA ACAGGTAACA GCACCA