Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT013456
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201061
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 213456
Nearest Genes
Gene Nr FlyBase ID Distance
CG14760 FBgn0033277 5220 bp
CG8705 FBgn0013726 9679 bp
Sequence Length 2091
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer GCGAAATGTACAATCAGGGGGTTGG
Right Primer CTGACGATTTGGGGATGAAACAGGG
Template genomic
Sequence GCGAAATGTA CAATCAGGGG GTTGGTTGGA AAACCGAGCC GACGAAGAAA GGGGGTTCGG GCAGGGGCAG GAGGTTGCCA GGGGTCGCTG AGGCGCAACG ACCTTTCCGC GTTCCGGGGG TTTTCTTTGC TTTTGCAGCT GTTGTTTTTG CTTGAACGAA AGATTTTCGT CAAGACACCC CGAAACAAAA AAACAGTCTT GGTTGTGTGC AACGCGTGTG AAAGTTCTGC AGTTCCTTAG TTCCGCACTG GATCCGTATT CCTGGCCACG CTTCAGCCAT TTTGTTCAGT ATTCTCCGGC TTTTTGGGCA GCCTATTCCC GATCTGGCTG CGGCGCACAA GAAACCCGTC CTTGGGTGGG GGGAATGTGG CAGAAGCGTG TGCTCCGGGA TCTAGGGGAG AAAACTGGCC CTCAGGATCT CACGTTGTGG CAACAAAAGA AGTTCGCCAA GGAAATTACA GTTCCTGTGA AGAGAGCTAA ATGTCGTAAA TTTTGGATTC ATTCTAAAAC AGCAGGCAAC AAAAAATCCC CATTTATTTT GGCATAAACT CGTATTGAGG GGAAAACAAG ATTGCGCAAC AAAAGGAATC TCCCATGGGT TTGTGGCAAA TCACCCGTGA TGAATTATGT TTTAAAGTAT TTTATTTGCT TCATTAGAAT TGTTTTTCAT TTGAGAAAAT ATATAGATTT TTGGTTAATT TCTTAAACTT GGATCAACAA ATTATGGATT AATCAGATAT ATTAAAGTTC TTGGAACTAA ATAGCATAAA TCAAAACAGA TTTTAAATTT CAGAGATACA ATTCTGCGAC GGGAGTCTGC AGTGCACATC ATCACTTCTT TATTTATGTT CAGTCAAATT CGTAATTTTT TTTTTTCCTT TTCCCATTTC CTAGTAACTA GAAGCTCAGT TGCTCTTCAT TTCGTTTGAA TATCAATTTT GTTTGTTGAA AAAATTATAC TGGCTGCCAA GTTCGATAAA ATTACAGTCT TCTTATCCAG ACAGACCTTG GGCTGTTCTA GTTCTCGGTT TGTTCATTAA TGTCTCTGAG CACTTACGGC TAAATTGTCG GCCAAGTCAA TGTAAACAAA TACGCGACCT TGATGGGCGC GCTAATGGCT TTATATGGCA CTCCCATTCG CACTGTGCGT GTGCATAATG TGCGATGCAG TGTCCTCGAC TCAAGGCTAC AGTTTATGAT TTGGCGAATT TCCAGCGAGG GAGTTCCGTG TAAGGGCTCG AAAGGATGAG ATGCGCAAAG TTGACGGCAG AACTGCTTGC GAGGAAGGAC TGTGGGTCAA AAGGATGCAA GAAAGGATAA CTTTATGGGC CGCTCATAAA GACCGTTTGA GCATTGGACA ATATGAGCAA TGGGTGATTA TTTGTTTTGG TCACAATAAA GACGGCGGGT GGCAAGGATA ATGCAAGGAT ATCCTTCTGC ATCCTCAAGC CATTAGCACG ACGATTAGCG GCTTGTACAA CGGGATGGTC TATTCGGCGG ATGGAAGGGC TGAGTGAAAC TTCCAGGAAT CGAAGGAACC TTTTACCGAT TCTCCCTGCA TTTTTTAGTT TTGCGTAAAA AATTCAGCTA GATTTGCGTA AAAAGCGCTT GTCAACGGTT TGAAGAGTCA GTTCGAATTC CAGGGATTAA AAAGGGCTTT GTTTTGGTTA GAAGGTAGTT TTATGTTAGC CAATAGTTTC GAGGAATCCT TTACATAATG TTTGCATGCT TGACATAAAA AGTGTGTTTA TATTTGCGTA AAAATAGTTG AATTCCTGCT AGGAAAGTAG AAACTGGGAA ACTAGAAAAA GGCTTTGTCT GGTTATGCGG CAATGTTATG TAAGCTTGTT GGGCCATTCT TACTTATTTA ATAGAAAATT CTTGGGAAAA GGCTTGCTGT GTTTTCACGA TAAAATTTAT TTGAGTGACA GCAGCAATCA TAAATAATCT GCCGATAAGC TGAATACATA TTTTATCAAA ATATTTGAGA GAAAATAAAC AGTTGATAGT TGTAAATCTC GCCCAAAAAA AAACTCAGGG CGAACCCACT AACTAATTTT CCCAGCCCCT GTTTCATCCC CAAATCGTCA G