Vienna Tile Information
VT ID VT048345
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201042
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 248345
Nearest Genes
Gene Nr FlyBase ID Distance
CG31062 FBgn0016061 17463 bp
CG13978 FBgn0039518 26072 bp
Sequence Length 2132
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GACCATCACAACAGCATTCCACTCAA
Right Primer ATCCTTCGCCAGGACGACAACAAAA
Template genomic
Sequence GACCATCACA ACAGCATTCC ACTCAAAGAT GAAAATTTGA AAGGCAAACA AATCTGTCCC ATAAGCAAAC CCCGGCTGTC TGTGGATCCT GGCTAGCTGG CTGGGATCTG GATGGGATGG GATGCAATGG AATGGCATTG CGAATTGAAG GCGCAGCTTC CGGAGCACGG ACTTATGGCT ACAAATCAGA AGGACCAACT TACCCCCGGC TGCTCTTTGG CTTTCCCTGG CTAGCTAATC CAAAGGACAG AGGAACTTTC AAGGCCTTCC AACTGGCAAG TTTAATTTAT GTTTTTGCTT GGCCAACAGA TAGAGAGCAA AACTTTTGCT GCTCGCAGCT ATTGTTCCAA TGCACTGACC CGTATTTGCA AAGATGTCTG CATAAGCAAT TTGTATCTTG TATCTACTAT CTTTGTATCT TGCGGATGCT CCGATGCACT TTCACTTTGC CCCGCCAGAC GATGGCAATT GTGATAAATT ATATGCCACG CGACCGATCG GATTGGATCG TTTCATATCA GATGGGAATC ATAATCAAAA CCGAAGGGGG CAGGCTGTAC GGCCGACGAA CTGTTGCGCC CACTCTCACA CACACACACA CTGATATACT CATATATATA CTGACCACTA CAAATGAAAC CGCAGTGTGT TATTGTGTCA TTAATTTGTG CGCTCTCTTT GTGTGGGAAT ACTCCTTTTT ATTGCTGCTT TTTTTGGCGC TTAAAGTGCG AAAACTGACT GGAATTAATT GATGATCCGC ACGCAGCTGG AGTGCGGTAT TGGTATTGTT GGTTGATTGG GAAATGGAAA ATCGAAAATG GGAAATCGTT AATGAGGCAG AGTGACGCGT TCACATTTCC ATATGATTTA ATGATTTACT TCGGGGGTCC TTCTATCTGC TCTACTACGC ACTTTTACGA ATTTTCCGCA ACTCACTTTT CAGTCTTGCT GTTTGTTTGC CCGCACTTGG AGTTTCATTT TCATTCGCAT TTTCCGCTTT CGGCTGTTAT TGCTGCTCGT AATCCGCTTT TGCCCTAAAT TTCGATTTCC TTTCGCTTTT TTTTTTGCAC TGCAGTTATT TCGAACTTCG CTTTTTCCAG TTCTCTTCAA GTGTTTTGAT AACTTGAGTG TATTATTATT TTTCCGGCAC GTTGTGTTAA TTCGTTTCTT CTTTTTTTTT CGTTGTTGTC GTTGTTGTTT CTGGTGGGCG GTAGGGGCGC GGCACACGAA ACGTAAACGA TGCGCAGCAC TTACGGCGCT CGAGAGTCAC GCACAAATGG TCCGCCGCCG CCTCCTATTC CTCTAATTAG CCACATAAAT TGCAAGTTGG CCAGGGCCAA AAGAATTCAA AACACACTGT CTAGAGAATC GCAATCCCTG CTGAGTAGTG GTGGCAATAG TGGCAAGCGC CAGCAATGGC ACAGATATAT GTAGCCAAAC ACGCTATCGA TATATAGAGC AGCACCCGCA CGACGAACCA AACGCTGTGA GCCACGGATA AGAACTAAAC AACATTCGCA GCTGCCGCTG CTCGGCTGCT GCTGCTGCTG CTGCTGCATG TTGTTGCTGC CGCTCGTTGC TGCTCGCTGC TGCTGCTACG GGGTAGCAAC ACATGCCGCA TATCATTCAC GATTTTTCAC TTCGGACGGC GACGAGCTTC GGATCACGAG TCCTGCCGCG CTCTCTCGTG CCGCATGTTG CTCGTGCGAG TCCTCGTGCA ACATGCGGCC AGGACGTGAC CTTTGGCAAC TGGTCGAGTG TTGTTTTGGC TCTCGGGCGC GCTTGCAGCC AATTAATGGG CCACTCGCCA TGTGATTTAT TGGCACCGCT CATAAGTCCC CCCCCCTCTT TGCCCAGACA GGATAAACAA AAAACACATG CATAATTTCC ATAAATCTTT TATGGCTGCG TGTAAAAACT TTCGGCTGGG CCAATTATGC GGACCGAACT AGGCACTAAT TTGACAGCAA AGTGCCCAAA AGGCTTTATC CCTCCTTGGG GGTCAGCCTA GGTCAACTCT GGCCACCCTC CACTCCGCCG TCGTTCGAAT CGTGTCCATA ACTTACCACA TAATTGAGTT ATCCCCCGGT TAGGGGCATG AACAAGCTTT TGTTGTCGTC CTGGCGAAGG AT