Vienna Tile Information
VT ID VT017419
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status unverified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201034
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 217419
Nearest Genes
Gene Nr FlyBase ID Distance
CG8355 FBgn0003425 5199 bp
Sequence Length 2113
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCCCATCCAACAAAATGTCGATTCA
Right Primer GCCTCATCATCGCCAACGTCATC
Template genomic
Sequence CCCCATCCAA CAAAATGTCG ATTCAAAAGG AAGTCTTCCC TCATATATTG AAAGAATTTA CAATTTTGAG AACTTTCACT CGTTGCCAAG TAAGTCTTTC CAACAATGGA AATTCTGATG ATGTTAATAC CCCACCACAA GAAAATCAGA CAAATTTATG TGAGCTTTCA ATTTTATAAT TGTATAAATA AACAACTATT AGCGGCACCG AAATGCGACA TAATTGTCCA GTAATCCTAA CTAATGAACC GACACAGAAG ATGAACATGA AAAATGGAAA ATGTGCTGCC CGAATGGTAA TGCGAATGGG AATGGGAATG TAAATGCAGA TCAGGCCAGT CTCAGTCCCA AGATTGGGAA TAGACCACCA GGTGTCACCG TCTCACGGTT TCCCATTGTT GTTTCTTGGT CGCTGCTTCT GCTGACCAAA TCCGGAAAAA AAATAAACCG AAATCAAATC AACAACAAAT AAATAGAAAC AAAAAAAACC GAGACAAAAA ATTCAAATGC AAATGCAAAC AAGGCCATAA AATTGAAAAT ATTTAATTAA AACGATGCGA CACATATCGG GAAAATGAGG CGGAAGGTGA GGGGCCTGAG AAATGCCCAA CTTTCCTGGT TTTCAACGTG GGCTGAAGTC TACGATCTAC TGTAGCATGT TGTTGGGTGT CTTTAACTGT TTGCGGCTCA AATATTTGGT TGCAACGAAA ATTAGAGAAA AAGAAGCTGT TCCGTGGCCA AAACGGCGGA GGGGTACGGG ACGCAAACTA CAACAGACAG CGCCTTTTAT TGGTTTGTTT GTGAGTTTGT GTGTAGGCTT CAAACGATGA GATGGAGACA ACGATGGCGA CAATGTGACA ACCACAACAA TGACAGGCTG CTGCAAAGAG AGTAATGTTC CGAGAGCATT CGAATCGAAG TGGGAATACC CTATAGATAG GAAAGTGCCA AAAGGATTGC TCAGGCTTTT CTACAACTAT CAAATGGTGC TCATATATCA TTTTCTGGCC CATTTCTTTC ACTTTCTTTT GTTCGGCATT CAACTCTATT TCCATTTTCA TTCATTTAAG AGATAAAATG ATTCAATTTT AACAACTTTA AGCTGGAAAT ATTTACATAA TTAAGATATG TGTGGCACAT GTTCAAAATG TATATTTTGA ATATAAAACG TTTCTTTAAA TCACTGGAAA GTTCTGCTCA CACAGTTCGA TTGCGTTAGT GGACATACCC TGCTATTGGT CAGGGTATTT ATGTATAATG AGGAGTCGGC GCAGATTTTA TTGCAGCATC ACGTCTACGT CAACGTTGTC TACCGGATGC CTGCAATATA TCAAACGGGA GTCGGCTCTC AAACTGGCCA TTGCATCTGT CCCGCTCTGT GTTTCCCTAT AGAAAATCCG CATTACCACA CCCCCACCAC CGGCGACTGG CGGTGTTTTG TCTGGCTCAC TTTTAATAAT TCCGCCCCGA GGGACCGGCG AACGGATGGT CACCTACACA CAACGGCAAT CGGAATGACA AACTATAACA ATAGGAATAT ACTCCAGGCA ATCCAATTGC AATGCCCGTC GTCTGAGTGT CCCTCGTCTG AGCTGCCCGT GAACCCCCTT GGATCCGGCC ATCTTCCCTC CATTTGTGTG CAGCGAGGCA TAGAAATTCC AAGTCCGACT CGCCTCCCCC CCTGCTCCGG ATTCAGTTGT CCATCCAAGC ACTGCCGTTA ATTATGGGAA GATTTCCCAT TGTACAAATG AGTTGGAAGA ACAACTTTTG TCAGGCCTAA TGATGGGTAG TGGACGTGGT AGTGGTAGTG GACTCCGGGG AAATGTCGCG TCTGGTTAGC TTCCAAAATT TATAGAAGAA CGCCTCCTCG GGATGGCCGG AAGAATGCAA ATGGCGGGGG AAAAGAGAAA CCAAATTGGT TTATTACATT CTTTCATTAG GAATGGGAAT GGGAACGGGA CGGAGAGCTG TCGCCCGAAA TCAACGACAA TCAAATAAAG TTTAAATACA TATTTTTATT TCATTACACA CTTGAAAGTC TAAGCCCCGA AACGAACTGT GTCTCGAGAG CCGGAGATTT CGATGATGAC GATGACGTTG GCGATGATGA GGC