Vienna Tile Information
VT ID VT017242
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201030
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 217242
Nearest Genes
Gene Nr FlyBase ID Distance
CG8204 FBgn0034033 21355 bp
Sequence Length 2164
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CAGGAGCCGCAATAGCCGACA
Right Primer CGATACAGCAGAGAGGGGAGCCAAG
Template genomic
Sequence CAGGAGCCGC AATAGCCGAC AGTAAACCAC AATTAACCAT CGCACCACCC AACCGCAGTG GTGCATCACC ATCACAATAT CACCATATTA CCATATCACA ATCGTCATAC TGGGGCACTC GAAAGTTAAT CACTTTTATT GGTCGCCATC GCCGTGTGGG AAGATGCCTG CTTGCAGTAA ACCGCAAAAA TGATGTGCAA AATAGTTTGG AAATTTTGCA AATTGCTGCA GTTGTTAGCA ATCAGCTGAA TGGACAATTT AAAGCCAAGG GAAAAGTGGA TGGATAATTT GTTGACATTT CATATTGGCT CAAGGCTTAG ATGGCCAAAA AAGTGGGCGG GGTCATTAGG GGGGGTTTTG CATTTGCTGC ATTTGGTTGG CGGTTTCCTA ATTTAATTCA AACTGGGAAA ACTGGGAAAA GTCTTGAAAG CAACAGTGGC TTAGGTATCG AAGAACATGA AATGAAACTT CTTGATTAAA GATATTTATA TCTTAATACC ACTTAGTATA TATATTGTTT GAGTAGTTTT AGAAATAATA CATTAAGGAT TCTTCATACG AGAAGTATGT GTTTCTTTCA CGTTTCTAAC ATTATAGGAA AAGGAAAATA ATCCGAACTG AGCTTTCACC ATAGATTAAA ATATCCATTT TCTGCAGAAT AATTGCAGCT GAAAATCCTG TGTGCACGGA TAAAATAGGC AGAAATAACG AGACAATTTT GTGATTCGTA GGAATTTTGT TCACTGTTTC CTAAGTTTAC CAGCTGAATA TATCCATTTC CATTTTCCAT CTCCTGCAGG ACGATGCACA TTCATGAAAC TGAGGCGGGT TATATGTCAA ATAGCCCACT TTTGGTCTTC GACTGACAAC AGCACATTCC TCAATTTCAT TTCCCATTTG GAAACTGAAG CGACGGCAGG GCTCATAGCT AAATGCAATT ATGCCAGCAA GGAGTGCAAA CCTCTAATGT AATCTAACTG CAGTTGCCTT TTGGCCTCTC GTCCTGTTCG TCCTTTTGCC CCAAACCAAA AAGCAGACAA GCTGCAACGA ATAAACATAT CAAAATTGCA TATTGTTTTA ATTGTTTTGT TACCGGGTTT CGGGTTGCGC CCGATGCCTA AACTGCAGAT TAACGCATTT ACACTGCACT GGATTCTGCA TCCTGGATCC TGGGTCCTGC CACACTACTC TCGCCCGCAA TCCTCCCCTT ACCCCACCTT AAGCACACAC ACACACACAT ACACGGCGTC ACGTAGAAAG AGCTCCTGGT TTATGCATTT GCATGCACTA AACACGCATA AATTTTGTGT GCAACCGTAA AGATGTCTCT GTCCTCGGCT CGGTGCGTTT TGCCTGGTTT ATGGCCATGG ATGGAGGTGG ACCCGGTTGC ACTGGCCAAA TATCTGCTGA ATTGGTCGAT GCATTCGGGT TTTATCGATA AATGTGTTGA TTATGCAGTG GAAACTACAT GGAAACGAGC TATTCAATCT ATGATTATGC AATCTTTGAA ATGTTTCAAT ATTTTTAGGC CATTATGCAT AATTGCAGTA TTTTTCTAAA GTGTATATGT TCATGAAGGG GGAAAAGGGG GGGGAAACGA TCATACATTG GGTGTGCAGT GCTCTGGTTT ATTTAGGATT CATATTTCGA TAAACAATTA TGCCAGTACC TGGGAGGACC GCTTGGCCAC ATAGCATGCG ATGCCTGTAA GCCGCCTTTA AATATGGCAA GTCGTTAAGG TAAGCCCCTC TGATTCCCCC ATGCCTCCCC CCGCCCCTTT TGGACACCAG ACCGCTTTTA CCCGCTCCTG TGCATTGCTG TGGATTTTAT CCCTTCTTAT TTCGTGGAGT AATGGCAGTG GGGGGCCGCA ATTGAAAATT TATTTTGTGT GCTCATTTTG CACCTAATTT CGAAGGCGGC CCCGAGGAAA TGAGTTGGCA AAAAGAGGAG TGCAAATGGG CAGTGCTGGG GGTAAAAGTC ATTTTCCGTG CCTGAACCCC TCGGCATGCC GCCCCGCCTG CTCCTTTGTT CCTTCGTTTG TTGTATATTT ATTTTAGATT TATTGTAATG TCCAGCAAAA AGATTGCCCA ACTGGCCTTA GTCCTCTTTA GTTTCTTCTG GCCCCCGATC TGCCTTATCC TTGGCTCCCC TCTCTGCTGT ATCG