Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT004437
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 201016
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 204437
Nearest Genes
Gene Nr FlyBase ID Distance
CG18024 FBgn0029123 5394 bp
CG9468 FBgn0032069 36806 bp
Sequence Length 2177
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GGATCTAATTGCAGAACGGGGCAAC
Right Primer TGAAGCTCTCGGATACAAAATCTTTTTAAGACCA
Template genomic
Sequence GGATCTAATT GCAGAACGGG GCAACCTTTT TCTCCTTCCC AACTCGTATT TTTTTTTTTT TTTGCCCAGC CCCGGCGACT GCAATTAAAA TGGAACCACG AGCAGGGCAA GGCCCATACC AGAGCATCTA GATGATTTCA GACGAAGCGA ACAGCATGCC GGAAAAATCG ACTCAAATTA CAGAGACTTA GCATCGGATC TCGGGTCGCT ACTGGCATAG CTACTGGTTT TGGGTATTGG TACTGTGGTG CTGGTACTAT GGTACTACCC CTACTCATAC CCCAGAAAAT CTCGACGGAG GAGGATTTCG TGTTTACAGT ACATCGTCGA ATAAAATTTG CGTACCCTAA TTGCCAGCTG TCGGCCGGGA GGATTTTGCA CAGTGTACTT TCTGCTAAAT TTGAGCGATC CCTTTTAGCT GATTGATCTC CAGCCCCGTT TCGATGAGTA ACTAGTTTGT AAATTTGCCG GGGACTTTGA TTTCGCATCG CTTTGTTTGT TGTTCTTAAT TTCATGCGGT CATGGGTTTC TATGAGTACT TAGTTTAATG TTACCCTAAA CGATACTTGG GCCATGCGCA ATTTTGTGTC TTCATTGTTG ATTAAGAGAT TCGATTGGGT GATAGCGCCG ATACAGGTGG TCTAATTATC TGTCTTACAC AGGGCGGCAT CGATTACATC TAGATCCCGA AAATATTCTC ATTTGAATTC ATTACCTTAG CGAGGCTAGC AAATAATTCT CAGGAATCTA AGGTATTGGG TAAGGATAAA ACTATAATTA TTTTGTAAGT ATTGTGCTTC AGTTCACCAT AAGTATTTAA AAATTTTAGA AATTACACCT TAATCCTATC TGTAATAAGA TACATTCGGA TTCAGTCTTA AATTTCCTAT GAAAATTCCT AATTATCTTT AAAGTAGCCA CAAACATCAA ACGTGGACCA CAAAACCCGA AGGCGTATTT GCCTTGAAAC AAAAGCTCGC TTCGCTTAAC AATTAGATCA GGCCTAAGTC AATTACAAAA CTTTTGCTTA CTAATTACTT ATGAATTAGT GAGTGGGCTG GTCAGTAAGT AGAAAACCAA ACAAAATTCA ACTGACCTTA AATCATTTAA TCAGCATGAA AGTCCCCGGG CCGTTTGGTA TATTTGCAAA ACTCAAACTG GGATGACAAC TGTTTGCAGA TTTTAATCTT TCACAAAAAG TCCACAGTCC GAGTACTCAC CCGGAATACG TACGTATATA CTATATAGTA TATGTATGGG GTATATATAT CGTGTCCAGT TCGGTGTCCA GAGGAGAGCA GCAAAAACTT GCTGTGACAC TTGTTAGACG GGCTGACAGC TGCTGGACTT TGGCCAGGAG CCGGGAGTCG GGAACTTGGA TTGGGATTGG GCTTGGGCTT GAGATTGGAA TCGGGATGTT CGGAGTGCAG ATGTTGTCGT CATCGTGGCG ATTCTCGTTG TCCTTCAGCG GCTCTGCAGC TGCCGAGAAC TTGGACCACC GGACAATGCG AGATGACGAC AAGTTTTTCT TGCCCGCCCA ACGACTTTGA CAGACGCCAT AACTTGGGAC GCAGAGCAAC GCCTTAACCC AGGGGCAGCT TCCTTGTAGC ACCACTCCAC CTCCAGCTAC CCAGCTACCC AACATCCCAA CATCCCAACA GCCCAACATC TCGACATCTC GAGTAATGAG GACAAAGTTT TGCATTCGTA ATGCGGACTG TGGACTTGAG CGACTGAGAC TGAGACTGCA CTGTGCTGCA GCGACTTGGG CTGCAAATGT TTCGGTGTTT CTGTGTTTCG GTGGTGGTCA GGCGTGGTGC AATTTGCAAA CTTCATTTAT TCACGCCCGG AGCGAAGCGC TAGATGAGCC CTTCCTTGTT GTTTGCTTTC CAGTTTCTGG CCAAAAGTTT GACGCTTTCG ACAAGGCATC GGAGCCCAAC AACTGAAGAC TCTTCACCCT GGGTTTCCTC CGCCATTCAT TTCAAATTAT TGGGCTCGTC GTGGAAGTCA ACGATTTGTC TGTCACTCGG CTGTTTAACC AGACTTTGTT GCATAAATGC TTCAGTTTTG AAGTAACATT TATGGGGTAC TTTGTTCGGT ACAATGTAGT TGTGAAGTAA CTATAAAATG TATGTATTTA AAATGGTCTT AAAAAGATTT TGTATCCGAG AGCTTCA