Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT060506
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200988
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 260506
Nearest Genes
Gene Nr FlyBase ID Distance
CG43368 FBgn0005563 32104 bp
Sequence Length 2193
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGGATGTGTTGGGATGTTTCTTGACC
Right Primer CTCAGCATCAAAATGAGAGCGCGTA
Template genomic
Sequence TGGATGTGTT GGGATGTTTC TTGACCCTCT AGTAATACGA CTAATTAATG TTATATATGA TATTAAATGT TTCCAGATTT TCTCTTGTGT TGACGTTGTG TAAAAACAAA TGGCAAATCT CTAGAAATAT CTAAGTATCA ATACATACAG TTTTTATGTA ACATTGTCAA CTCTGTTTTT ATTTTGTTTG TCGTATCTAC TTAGAACGAA CATACAATCG CAAACTGGAG AATCAAAATA CGAACTTCTC AACTCTACCG ATATATATGT TGGTATATAT ATATATAAAT TTGAGTATGT AGTTACTTAA AGTTACTCTC GACTTCTACT GAACGGTTTT CCATTGCTCA TTATACGAGT TAAGTTTAAC CGTAATCCCT ATTGGGTTGC AATATTTTCA GCTATCGATT TTGGATCGAG AAGGCGAAAA CTATGCATCC CACATAGTGA CAGATCCAAG AGTTCTTATA TCTAATATCT GAATGGAATC ATAGTTTATT TCAACTTTTT CGGTAATTTT CCTCTGGATC CGCCTCTTTT AATCCCACAT GCCTGCCCGT AGATAATTTC AAATTTTCAT ATTTTTGAGA AATATTTGGG ATCGAATCTG ATCGGGCCTG ATTTAGCCAA ATAATGGGCA GTTGCGTGTA CACATACTTT ATAATATATG TACGCAACTA TGTGGTTATA TATGTAAATG CGATTGTGTA GTTCTAAGTT TCGTGTATTT GAGTCACATA CAAACGGGCA TGTATGTGCG AAATATATAG GGTATTGTAT ATACAAATGT GATAAACATG AGGTTGCATA TAAAATTAAT TATATACCTC CTTCCAGTTC TGCATATTTT CATTTAATTT GTTTACGTTT TTTTTTTTGT AATTTAAATT GTTGTTTATG AAAGAGTTCA TATTCAGTCG TATGAGAAGA GAAATCATAA TATCACATAT TTATTCCATG GTATATAGAT TTTATAGAAT ATATTTTGTA GTTTGTGTAG TTTCGTTTCA AAATGTAGGT TGTTTTGGGG TGAAAAGACA TTTTATCTTT GCTCTTAAGC GGAAAATCGC CCTAAAATAT TTAATACCCC TGAAGTTGAG GAGCTCAGAA TACATAAAAC TATAGTCAAA TACTTGTTAT TTAAAAACCA TATTTTGTAA TATATAGTAA GTTTCTGTGT TATATACATA AACGTTCCGA CGATGCGGAT TATAAAACCT TTTATTCAAA TAAAGTATAT TTTTTGAACA GCTAAAACTG AAAAGCTGAT AACACTTTAG GTTTATATCT ATTCTTGATA TATTGTATAT ATGTACATAG CTTAGGAAAG TTGAAAGTTG TGACGCTTTT TTGTAATTCA GGGCGATTTT TTTTAGAGTG CAGTGAGCTT AAAGTGCTTA GAATTTGCAA AAGACTGATA GATAGATAGT TGACTTATAT AAATCCCTAA TCCTGGCAGG ACATTGGCTA AATGTAAACT TAGACTTATC ATTACATTAA AGAGGACGAA TCGACTCCAA ATAAATCTGC CTATATTTCG GGCCTTGCTG ATGCCTAAGG ATTCCTAACG AGTCGAACCT TAAGTGGCTA CCATAAAACT GGGTAATATC TCGACTGGGC GAGTCAGTCC CGGGTAACAC GGTGGTCTGA CCACCGAATA TCGACTCATC TTCGACTCTA CGCAACTGGA GTTGTGCGGT AGTTTGTGTT TAAGGGGCTG AATAAATGGT TATCTTGAGT GGCTTACCGG CATTCCCGAA TCGAGTTGGC CAAACCGCGT GCTACGCCAG GACTCCAGGA TGAGGAAACC TGCATAGATT TTACCCACTG ACAGTTTGCC CTTGTTGAGC TGATCGCTGG GCGGCACCAG CAGGTTTAGC ATCTTCTTCG CCTGCAATGG CCAGATGTTC GTGATGGTCT CCCGCAGTTC CATGTCCGCC TGGTCCATCT CCTCAGCTGA TGGTTAGATG AATATGATTA GTATAGAACA TTATATTGAT ACCATTAAGA ACATAAACCC AAATTACACA ACAGAAGTGC TGTGTTTTGA GGTAAAATCT ATAAATTCTA AACATGCCAT TTTGTTTCTT TAAAATTGAT ATACTACTAT ATAATAATCG AAGTGATACA TGCTATGTAA TTATACATTG ACTATCAGTA GAAATACATA CGCGCTCTCA TTTTGATGCT GAG