Vienna Tile Information
VT ID VT057465
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200977
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 257465
Nearest Genes
Gene Nr FlyBase ID Distance
CG15765 FBgn0029814 3342 bp
Sequence Length 2125
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AGTTGCTCCTCCCGCTCTTTCTGC
Right Primer ATCCTCGTTAACCTGCATCCTGCCC
Template genomic
Sequence AGTTGCTCCT CCCGCTCTTT CTGCACCTCC TGCTCCGCTT CCAGTTTCAC TTTGCCCGGC ATCCGCCTGC GAGTCACCCA CAGCACCACC CACTCAAGGA CGCGTCCGGC GAAGGCCGAC CAGCAGACAC AGAAGGCAGT GCCAAAGAGA GACGTAAAAA AGGAGGAAAA TCGGAAGAAA AAAGCAGCCT ATCCGACCTT GAGCTGCATT CACCTACCGC CATTTGGCCA TCACCCATCA CCGCCATCAC CGACAGGCGC CCAACTATTT CGCACATCAA ATCATAATTT ATGGACGGCA ATCAAAATGA GCCTGAATTC CCATTCCATT CCATTTTTTT TTTTTTTTTA CATTTCGGTT ATATTTGATG ATGGCTTGGG CTGGTGCGAA AAAGTTGCGC AGTCGCCCAC ATAATTATCG GTTTGATTTA TGGCAGCATT TTCGCAGCCA ATTACTTCGC ACCAGCTGAA ACGTAGGGGA AAAAACGGAA CCGGAAGTTC AAATGAACCA CTGAGCGAGC GCATATCGAA TCCTTGGCAG CTTACCTATC TACAATATAT CCTTGGCCAT ATTGCCACCA AAAGAGCCCC GCTGATTGTG ATCTCCTGTT GGCCTGGCCA ACCTTGAAGT CAGTCAAAAC TCGCTGTGAA TGCCCATGAT GATTTTGTGA GTTGCATGCA GTGCCTGAAG GACATTCAGT CAGGACATTC AAGTGGAGAA AAGAAAAAAA GCTTTCAGGC AAACAAACTG CCATGCAATC GAATTTTGTT CATACAAATT TTGTTGTGCC TTACTTTACA TACATATTTG CATAGTTTAC AGTGTAGAGA AATTAAATGA GTCCTCTAGA CCCGGTTGGC AATCCAGCAG GACATTAACA AAGTTGGCGC CCAGCGCACA AAAAGACAAA CAGACAAAAT GGACAAATAG ACAAACAGAA TGACAGATGG ACAGAGTCGG ATAAACAGAT GGACCATCAA ATGGTTGACA CACACGTATA TATCTTCGCC GAGCAAGGAC AATGGGAACC AGGTCAACTG GGGCACAGAG GTGAAGGCAA AAGAGTCGAC AGCCAGCTGC CAACCCGAAA ATTTTCACCG AACCTGAAGG CTTAAGTGGG AAATGCTGGT TAAGCTCGAT TGCCATGGAA ATGTATGCTT TTTTTTCTGC TGCCATTTTC GGGCATTTGG CCTTGTTGAA TTTGAATACT CACCGAATGT GTACGAAAAG AAATATAATG CCACACATAT GATGACGTGT TAATTTTGCT TAATTTATGA AATTAGCAAC GTTCTGACTA CGAGTTTTCA ACACAAAATT GCGGACTATG TTTCGGCTTT TCCTCTGTTC CTTTCGATGG AAGGAACTTT TGTATAATTG CGTTATCTGC TCCACACCCC GACCATTGAA AAGTTGAAAA GTGTTTGCAT TCAGCTTCAT CAGCTGATTG CCGGCAGGTT CAAAGCATCA AAGCGAAGAA GGCAAACTTT CAGGGGGGGG AATGCGAAAT GGGGAAAATG CGTCAGTTAG TCGAGTTGAG GTGTGTTGAC ACATCGTTTA GGCCAATTTG CGAATTTTGT TGCAAATCTG CCAGAGACTT CATTTTCCAA AAGTCTTGCA TATGAGAACT TGATTTCCTT TTCAACACTT CTGTTCCAAA TATTATGTGA AACATACATA GAATAAGTAT GGACAGATAT CACATTGAAA CACCTCGTCC TCTAAGGTAT TTCGACTGCA TAAACTAGCC AGGCGAGTCA ATTTCATTCC CTATCGAATG CCAAATGACT TTATATATAA ATTAATTATT TCTTAGTCCC ACGACCGCCG AGTGGTTAAC CCGATTAGAA ATACAGTCCA TTCGCATACG CAATGGCGTC GGGAATTCGA AATTGGAAAC TGCAAGTCGG AATGCATCGG CAATGTTTGC GCTGCTCTGT GGTCGTCGGT TGTGCTGCAA TCCTCGAATG TTGACAAACG TAATTAAGAA ATTGTTAGGC CCGTCAAATG GCAGGGGGGG GGGGTGGGGG TTAGTTGCAC AAATGTTTGC CCACCGCAAT GGATGCCCCA TAGATATCAG ATACTGCTGT GTGCGTCTGT GGGCAGGATG CAGGTTAACG AGGAT