Vienna Tile Information
VT ID VT057224
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200965
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 257224
Nearest Genes
Gene Nr FlyBase ID Distance
CG4209 FBgn0010014 1589 bp
CG10706 FBgn0029761 3670 bp
Sequence Length 2237
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGATTGGGATTGTTCGCATCATCTT
Right Primer CTAAATGCCAGAGCCCATAAGCCCA
Template genomic
Sequence CGATTGGGAT TGTTCGCATC ATCTTAAACT AGTTTGTACT ATATCCTAAA CTCTACGTTC AATTCAAGCC TAACACTTAA GTTCATCTCT CGACTAAATG TTGTGTATAA GATATGTAAA AAAATCAAAA AAAAAAAAAA AAAAAAAATT GACAAAAGAA AACTACAACA ACAACTACAA TTAAACACTG TTTATCGCAA AGCTAAACTC AAAACCCCCA ACAAGCGTTT ACTTGGTGAT TTTTCGTTGT ACTACCACTA TCTGTTGATG GGAGGTGGAC GAATGTGGGC TGGGTTCTTT GGCCGGCGGG TTCAGATGCC CTCAGAGTTC CACGGTCCGC GAGTCCTTGG ACGAAGAACA CGTGCGTGTC GTTCAGCTCG GCGCCCGAAA TTCCGGATTC CCGAAAGCCG ACCCCGTAGA AGATGGTCAC CACAAAATGT GGGAAGGAAG CCACCGGCCG AAAGTAACCG AAAACTTTTT GGCCGTTGGC AACGATTAAA TGTTTTGTAG GTCACCGATT TTCCAACTAC ACGTGTGTGT GTGTGTGACG TCCCTCATGT GACAAGACAC ACCAACATAC ATGTTACGTA TACGCCACGT TGTTTAGAAC AAAGCAGTGG AAGAAGTTCA TCCATGTTGA GATTAAAATT ACCTTAGTAT AGAGCAGAAA TGTCACAAAT GAGTGGGAAA AGTTTATCCA TTGATATAAA ACATCTATCT ACTAATGAAA CATAAATATT ACGTATACGC CACGTTGTTC AGTACAAATT TGCGAATGCG GAGCCTTCCT GTGGATTTAA AATAGAACAT AAATATCGCA AAGCATTAAG AGATGATAAT CCATGTTGAT ATAAAACACT TAAAAAAATG TTACGTATAC GCCATGTTGT TCAATACAAA TCAGTTGGAG AAGATCATCC CTGCTGCCGC AGAATACTAT TTTATATATT TCCCACATTT TTGGTACCGA ACTCAACAAG AATTTCTCGC AGTGTGGACA ACAGGAAGCC AGCCAACTAG CTGTTGGGTC CGCGTAGAAC TTGTACGGTA ACAGAGCCTT GACCACGGAG TCACCTGCTG GGCGATTGGG CCACAGTATT AGTGAACTAG GGAGGTCCTG CGAGGGTCCT TTGTGTGCGC CAGTGTGCGA GAATGCGTGA GTGTGTGTGC GTGGTATCAA TAAATTATTA TATGCTGTCT GTCGCAAGCT GGTTCGTTAA TCATTTTCGC CTGGGCCCTG CCCCCCGCCC CCTGCCACCT GCCCACGCTT CGAATCCGAC CTCCAAATGA AGGCATTTCC ATTTTGAAAA TTAGTAGGGT TAATGCTGAA GTTACACCCG TACACCCGTA TACCCGTACA CACGATTCCC AAGGAGCAAC CTGCAGCCCA CTAATTTCGC TCCTGTTGCT GCGTCACGAG CCCACGGTTT GACCTTTTTC CGATTGCTAT TAATTGGTTT GATTAATGTG CTCCAATTTT CGGATGGTAC GTAATGTCGC CGGTCCCCAA TAATCGAGCA TTTCCATACC GACCAATGCG TCCATCATTT CATTCACGGG ACTTGTATTA ATCGATGGGC CATACATACA ATTTGTTACT TCGATGGGTT TTTCGAATGG GACAGGTGAT ATATACATTT ATATATTTCC GGGCACGGCG AGGAGATGAT CAAGTTTAGA TAATAGCATA ATATATGTAT ATCTGCGCTT CGGGCAAATA TTATTCAATT TTCTATCGAA AGATTACCGG TCGGTCATTG ATGTCATCCC AAAATCTGAG GCACCCCCAT CTTGCCACAA AACCTATTGA TCCCTTTTTT TGTATTTGTG TGTGTTTTTT TTTGTTTTTG TCTCCGTTTA TTTTTGGATA CCTTTTTGCC GCTTCTGTTG GCCGAAGTTG CCTCAAACTT ATTTCGCTTG AATAACTTCG TTTCGGTGGC AACTATTTAG TCAAACGGGT TTTTATAAAT TATGCATGTA CAGAAATTCT CCCAATTTTA ATGGGCTGGC GAGCGAAGAA GGGAGGGGGT ATATACCTGT TTACCACCAA CACAAATCAA TATACCTCAT ATATACTTTC ATACATATAC ACATATATAT ATTTATATAT CATGTGTGTG TAATGGAGTT CGGACAGGTT AGGGATATCG CATAGCCTCC AAACGAAATT GTCAGCTTTC ATTCCGCATA GTCCTTGGCC AACCGAAATC TCTGGGCTTA TGGGCTCTGG CATTTAG